View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21347_high_88 (Length: 209)

Name: NF21347_high_88
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21347_high_88
NF21347_high_88
[»] chr2 (3 HSPs)
chr2 (17-162)||(7127907-7128052)
chr2 (31-161)||(7133173-7133303)
chr2 (156-191)||(7127862-7127897)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 7128052 - 7127907
Alignment:
17 aagggctttgaaggggaaattagagaggaatcttacatcttattggtctattggtgatggtttaactgctaactcttgaagtggttgttggatagtgaaa 116  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7128052 aagggctttgaaggggaaaatagagaggaatcttacatcttattggtctattggtgatggtttaactgctaactcttgaagtggttgttggatagtgaaa 7127953  T
117 ctttatgtattgcagaattggttgacaatattccgattgagtggct 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
7127952 ctttatgtattgcagaattggttgacaatattccgattgagtggct 7127907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 31 - 161
Target Start/End: Complemental strand, 7133303 - 7133173
Alignment:
31 ggaaattagagaggaatcttacatcttattggtctattggtgatggtttaactgctaactcttgaagtggttgttgga-tagtgaaactttatgtattgc 129  Q
    ||||| ||||||| |||||| ||||||||| |||||||||||||||||||| ||||||| |||| ||| ||| ||||| |||||||| ||||||||||||    
7133303 ggaaaatagagagaaatctttcatcttatttgtctattggtgatggtttaaatgctaacgcttggagtagtttttggagtagtgaaa-tttatgtattgc 7133205  T
130 agaattggttgacaatattccgattgagtggc 161  Q
    |||| ||||||||||||||| |||||||||||    
7133204 agaagtggttgacaatattctgattgagtggc 7133173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 191
Target Start/End: Complemental strand, 7127897 - 7127862
Alignment:
156 agtggctattagatattgattgttgttggctagagg 191  Q
    ||||||||||||||||||||||||||||||||||||    
7127897 agtggctattagatattgattgttgttggctagagg 7127862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University