View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_23 (Length: 396)
Name: NF21347_low_23
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 4953618 - 4953391
Alignment:
| Q |
1 |
tttgcattggagcagcatgtggagtacactatcttcacacaggaacaaaatgtaccatttttcattgtgacattcaacctcataaaattttataggatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4953618 |
tttgcattggagcagcatgtggagtacactatcttcacacaggaacaaaacgtaccatttttcattgtgacattcaacctcataaaattttattggatag |
4953519 |
T |
|
| Q |
101 |
taacatggtgcctaaactctcagatttttggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatattaagtgataacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953518 |
taacatggtgcctaaactctcagatttttggacttcattgcaaggacctttgtttactgattcaatgccgaaaccaaagtccatattaagtgataacatt |
4953419 |
T |
|
| Q |
201 |
ataggtatgtacccttttctctatcatt |
228 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
4953418 |
ataggtatgtacccttttctctaccatt |
4953391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 323 - 371
Target Start/End: Original strand, 3265977 - 3266025
Alignment:
| Q |
323 |
tgattggtttcaagaatgatgtggcatgtttgtgttccttagatttcaa |
371 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
3265977 |
tgattgatttcaagaatgatgtgaaatgttagtgtcccttagatttcaa |
3266025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University