View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_30 (Length: 354)
Name: NF21347_low_30
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 102 - 339
Target Start/End: Original strand, 31031114 - 31031349
Alignment:
| Q |
102 |
aaggagtactcgccccttaagcatgatgtaacataacttggggatattatcttatcttcttaccccttaaagtttttacaagacagtttacttaaatgtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31031114 |
aaggagtactcgccccttaagcatgatgtaatataacttggggctattatcttatcttcttaccccttaaagtttttacaagacagtttacttaaatgtt |
31031213 |
T |
 |
| Q |
202 |
taatttttatttaattcacttcttattatcggtgcttcattttcgtcataagaagagccagatgcttccaatttttatcttctttatattataatactat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31031214 |
taatttttatttaattcacttcttattatcggtgcttcattttcgtcataagaagagccagatgcttccaatttttatcttctttatattataatattat |
31031313 |
T |
 |
| Q |
302 |
ttcatcacttttttcctgtgctgcccttatttgtgcat |
339 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31031314 |
ttcat--cttttttcctgtgctgcccttatttgtgcat |
31031349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University