View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_49 (Length: 291)
Name: NF21347_low_49
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 20 - 288
Target Start/End: Complemental strand, 22512303 - 22512035
Alignment:
| Q |
20 |
gaagaagtgtatggtcgaaccctctatacataattgtgctaaattcaccttcaattcttaattggtattttgcacgcgaaaatagatcttggcgcgagtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22512303 |
gaagaagtgtatggtcgaaccctctatacataattgtgctaaattcaccttcaattcttaattggtattttgcacgcgaaaatagatcttggcgcgagtg |
22512204 |
T |
|
| Q |
120 |
atccacccagctgggtcatcgccggtgaacatagacaattccactttctttacaaatctgcggaattcttccaagttgtttccggtgaatgatttcttca |
219 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||| ||| |||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22512203 |
atccacccagctgggtcatcgccggcgaacataggcaattccactttcttcacagatctgctgaattcttccaagttgtttccggtgaacgatttcttca |
22512104 |
T |
|
| Q |
220 |
tcttggttttatcatcactgacgtcacccatgtccttttccttcactacagacttccctttgcttctcc |
288 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
22512103 |
tctcggttttatcatcactgacgtcacccatgtccttttccttcactacagacttcccttagctactcc |
22512035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University