View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_58 (Length: 256)
Name: NF21347_low_58
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 48 - 238
Target Start/End: Complemental strand, 45351235 - 45351044
Alignment:
| Q |
48 |
acaattatgtgggttgtcttgtcaagtggcatatatttgttttatgaagtttttccttaa-tcagaaccatgataatgaaatgcatattattgaattatc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45351235 |
acaattatgtgggttgtcttgtcaagtggcatatatttgttttatgaagtttttccttaaatcagaaccatgataatgaaatgcatattattgaattatt |
45351136 |
T |
 |
| Q |
147 |
atttgaaatcttgcaaacttgatctattcgatcgttttttatattcaacccccggatcgattaaatatttacattttacatgtagttattaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45351135 |
atttgaaatcttgcaaacttgatctattcgattgttttttatattcaacccccggatcgattaaatatttacattttacatgtagttattaa |
45351044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University