View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_62 (Length: 254)
Name: NF21347_low_62
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 12422943 - 12422842
Alignment:
| Q |
1 |
gtgattttccattatttggtgtgatgactttgcttgtgagatgttgagcatgggagatgataaaagagaaaacgtcttgcaaatgaatgtcttttagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12422943 |
gtgattttccattatttggtgtgatgactttg----tgagatgttgagcatgggagatgataaaagagaaaacgtcttgctaatgaatgtcttttagatg |
12422848 |
T |
|
| Q |
101 |
cttttt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
12422847 |
cttttt |
12422842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 173 - 238
Target Start/End: Complemental strand, 12422373 - 12422308
Alignment:
| Q |
173 |
tatttcttctttctcaacatgctagcactgtgttgttgattgcacagaaatcgcaaatgtaaaaga |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12422373 |
tatttcttctttctcaacatgctagcagtgtgttgttgattgcacataaatcgcaaatgtaaaaga |
12422308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University