View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_72 (Length: 241)
Name: NF21347_low_72
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_72 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 32983831 - 32983608
Alignment:
| Q |
1 |
aacatcctataaaaacaagttttgagataacacgtttttctactaatggtaacgcgatttctttgagaagtaaaatgataatacatatatatat----gt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32983831 |
aacatcctataaaaacaagttttgagataacacgtttttctactaatggtaacgcgatttctttgagaagtaaaatgataatacatatatatatatatgt |
32983732 |
T |
|
| Q |
97 |
caaataattaatgtgatcattttgtgttttatttaagaaaagcatttgcactatattggctagaatgtatatatgtagacatgcaatggagagattgatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
32983731 |
caaataattaatgtgatcattttgtgttttatttaagaaaagcatttgcactatattggctagaatgaatgtatgtagacatgcaatggagagattgatt |
32983632 |
T |
|
| Q |
197 |
ctaaaccctcaaacaccaactagc |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32983631 |
ctaaaccctcaaacaccaactagc |
32983608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University