View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21347_low_83 (Length: 231)

Name: NF21347_low_83
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21347_low_83
NF21347_low_83
[»] chr2 (1 HSPs)
chr2 (16-215)||(8850320-8850520)


Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 8850320 - 8850520
Alignment:
16 cataggagcaaaccagataggtcgttgttgtatacctgtctcaatttaattgatgatcgataaactaaaattgagccactcatggcaaatcaaatgatat 115  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8850320 cataagagcaaaccagataggtcgttgttgtatacctgtctcaatttaattgatgatcgataaactaaaattgagccactcatggcaaatcaaatgatat 8850419  T
116 aggtataattgttttatgactatcaaggaatgatgtgatgagtataaataaaaactcaatgtagtattaattaagttat-aaagatcttccacctaataa 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
8850420 aggtataattgttttatgactatcaaggaatgatgtgatgagtataaataaaaactcaatgtattattaattaagttataaaagatcttccacctaataa 8850519  T
215 t 215  Q
    |    
8850520 t 8850520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University