View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_83 (Length: 231)
Name: NF21347_low_83
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_83 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 8850320 - 8850520
Alignment:
| Q |
16 |
cataggagcaaaccagataggtcgttgttgtatacctgtctcaatttaattgatgatcgataaactaaaattgagccactcatggcaaatcaaatgatat |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8850320 |
cataagagcaaaccagataggtcgttgttgtatacctgtctcaatttaattgatgatcgataaactaaaattgagccactcatggcaaatcaaatgatat |
8850419 |
T |
 |
| Q |
116 |
aggtataattgttttatgactatcaaggaatgatgtgatgagtataaataaaaactcaatgtagtattaattaagttat-aaagatcttccacctaataa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8850420 |
aggtataattgttttatgactatcaaggaatgatgtgatgagtataaataaaaactcaatgtattattaattaagttataaaagatcttccacctaataa |
8850519 |
T |
 |
| Q |
215 |
t |
215 |
Q |
| |
|
| |
|
|
| T |
8850520 |
t |
8850520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University