View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_85 (Length: 227)
Name: NF21347_low_85
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_85 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 11731086 - 11731307
Alignment:
| Q |
7 |
ggaactttatttaggactttcaacctacagcccgtaaatttgacagaactcagattttaataacttcacaattaccgctttctaatgccgacccttctta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11731086 |
ggaactttatttaggactttcaacctacagcccgtaattttgacagaactcagattttaataacttcacaattactgctttctaatgccgacccttctta |
11731185 |
T |
 |
| Q |
107 |
agtatctattgaatggacagtatgagcagatcgttttcatttacttaataat-acatttagattaagagtgcacatcctcctacaaaattagaaaaacta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11731186 |
agtatctattgaatggacagtatgagcagatcgttttcatttacttaataataacatttagattaagagtgcacatcctcctacaaaattagaaaaacta |
11731285 |
T |
 |
| Q |
206 |
gcaatcttgacaaggatttgta |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11731286 |
gcaatcttgacaaggatttgta |
11731307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University