View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_87 (Length: 225)
Name: NF21347_low_87
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_87 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 23 - 225
Target Start/End: Original strand, 8255580 - 8255782
Alignment:
| Q |
23 |
gaaagaaacgacacatgaccttgtgtggtatcagaatcttcggcgttaatgttgggcaaaaacgccacactttcaaggctgaaagggcacttttctacac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255580 |
gaaagaaacgacacatgaccttgtgtggtatcagaatcttcggcgttaatgttgggcaaaaacgccacactttcaaggctgaaagggcacttttctacaa |
8255679 |
T |
 |
| Q |
123 |
cgttaatgttgggcatcaaaatcttcagcgttgaatgctactcttcaggttcagggcgttaggcaccctagtagcagtgatgcactgtgatgttttccaa |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
8255680 |
cgttaatgttgggcgtcaaaatcttcagtgttgaatgctactcttcaggttcagggtgttaggcaccctagtagcagtcatgcgctgtgatgttttccaa |
8255779 |
T |
 |
| Q |
223 |
ttt |
225 |
Q |
| |
|
||| |
|
|
| T |
8255780 |
ttt |
8255782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University