View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21347_low_92 (Length: 209)
Name: NF21347_low_92
Description: NF21347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21347_low_92 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 7128052 - 7127907
Alignment:
| Q |
17 |
aagggctttgaaggggaaattagagaggaatcttacatcttattggtctattggtgatggtttaactgctaactcttgaagtggttgttggatagtgaaa |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128052 |
aagggctttgaaggggaaaatagagaggaatcttacatcttattggtctattggtgatggtttaactgctaactcttgaagtggttgttggatagtgaaa |
7127953 |
T |
|
| Q |
117 |
ctttatgtattgcagaattggttgacaatattccgattgagtggct |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127952 |
ctttatgtattgcagaattggttgacaatattccgattgagtggct |
7127907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 31 - 161
Target Start/End: Complemental strand, 7133303 - 7133173
Alignment:
| Q |
31 |
ggaaattagagaggaatcttacatcttattggtctattggtgatggtttaactgctaactcttgaagtggttgttgga-tagtgaaactttatgtattgc |
129 |
Q |
| |
|
||||| ||||||| |||||| ||||||||| |||||||||||||||||||| ||||||| |||| ||| ||| ||||| |||||||| |||||||||||| |
|
|
| T |
7133303 |
ggaaaatagagagaaatctttcatcttatttgtctattggtgatggtttaaatgctaacgcttggagtagtttttggagtagtgaaa-tttatgtattgc |
7133205 |
T |
|
| Q |
130 |
agaattggttgacaatattccgattgagtggc |
161 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| |
|
|
| T |
7133204 |
agaagtggttgacaatattctgattgagtggc |
7133173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 191
Target Start/End: Complemental strand, 7127897 - 7127862
Alignment:
| Q |
156 |
agtggctattagatattgattgttgttggctagagg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127897 |
agtggctattagatattgattgttgttggctagagg |
7127862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University