View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21348_low_3 (Length: 299)
Name: NF21348_low_3
Description: NF21348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21348_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 35 - 282
Target Start/End: Original strand, 13152958 - 13153205
Alignment:
| Q |
35 |
aatttagggtgtaacacatgtttggaaaaactaaacaatggtggaaattagagtgagtttgtgattatcattgacgagcatttaatgtggtcagtgatta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13152958 |
aatttagggtgtaacacatgtttggaaaaactaaacaatggtggaaattagagtgagtttgtgattatcattgacgagcatttaatgtggtcagtgatta |
13153057 |
T |
 |
| Q |
135 |
tagaactctctgcatggttgcttgaaagtcattgatcacactgaaaggcattcatcagttatgaatttctgatcacattatggactgatgaggacaatat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13153058 |
tagaactctctgcatggttgcttgaaagtcattgatcacactgaaaggcattcatcagttctgaatttctgatcacattatggactgatgaggacaatat |
13153157 |
T |
 |
| Q |
235 |
tattaatgtatgtaggttctgtttccattgaatcatgatgtggaggct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
13153158 |
tattaatgtatgtaggttctgtttccattgagtcaagatgtgaaggct |
13153205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University