View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21349_high_2 (Length: 234)
Name: NF21349_high_2
Description: NF21349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21349_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 220
Target Start/End: Complemental strand, 31729854 - 31729742
Alignment:
| Q |
108 |
catgattgtgggttttttggagttgtttttataattgacaatggtgtttgttttcaacaattgtgcaagtaaaaatggtttgtgaatctaaattgaagta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31729854 |
catgattgtgggttttttggagttgtttttataattgacaatggtgtttgttttcaacaattgtgcaagtaaaaatggtttgtgaatctaaattgaagta |
31729755 |
T |
 |
| Q |
208 |
ttaggcttagaag |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31729754 |
ttaggcttagaag |
31729742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 15 - 110
Target Start/End: Complemental strand, 31729984 - 31729889
Alignment:
| Q |
15 |
acagacatatgatcctactatataatagtatatttattcaaattcaaccgctcttttcactgtcaaaaaagtgcattgtaagttgtaaacaaacat |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31729984 |
acagacatatgatcctactatataatggtatatttattcaaattcaaccgctcttttcactgtcaaaaaagtgcattgtaagttgtaaacaaacat |
31729889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University