View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21349_low_5 (Length: 235)
Name: NF21349_low_5
Description: NF21349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21349_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 26633312 - 26633171
Alignment:
| Q |
1 |
ttttgttaatattttttgattttattatttataacttcatacaagaaaatgtgttcgttattgtgagaaggttggagtaactttttcctaggtttgccaa |
100 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26633312 |
ttttgtaaatatttttt-attttattatttataacttcatacaagaaaatgggttcgttattgtgagaaggttggagtaactttttcctaggtttgccaa |
26633214 |
T |
|
| Q |
101 |
tggcacgagatttttcatgttgtgtacttgtgacatcagctag |
143 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
26633213 |
tggcacgagatttttcatgttgtgcacttgtggcatcagctag |
26633171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 151 - 222
Target Start/End: Complemental strand, 26632584 - 26632513
Alignment:
| Q |
151 |
atatatatatgagttatattataattcaatgcttcagtgttgtcgtagaaagttatgatgcaaatggttttt |
222 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
26632584 |
atatatattagagttttattataattcaatgcttcagtgttgtcatagaaagttacgatgcaaatggttttt |
26632513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University