View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2134_high_1 (Length: 467)
Name: NF2134_high_1
Description: NF2134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2134_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 25538135 - 25538096
Alignment:
| Q |
411 |
taaggaagctatagagtcttatgagtcttatgactttgat |
450 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25538135 |
taaggaagctatagagtcttatgagtcttttgactttgat |
25538096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University