View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2134_low_4 (Length: 325)
Name: NF2134_low_4
Description: NF2134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2134_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 181 - 308
Target Start/End: Complemental strand, 8172672 - 8172545
Alignment:
| Q |
181 |
cataaaattactgtgtgcaagaatgaattgaatatacaaataggttgttaactgaccaatatcacaagaataactcattcatgatttaaaatcttcaaca |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8172672 |
cataaaattactgtgtgcaagaatgaattgaatattcaaataggttgttaactgaccaaaatcacaagaataactcattcatgatttaaaatcttcaaca |
8172573 |
T |
 |
| Q |
281 |
tgaagtaaagagtggaatgagtcttttt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8172572 |
tgaagtaaagagtggaatgagtcttttt |
8172545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 36 - 111
Target Start/End: Complemental strand, 8172813 - 8172738
Alignment:
| Q |
36 |
aagtttggcctcgatagcaaaagaaaaacgttttttgtttacataattcactattttattaaaaatgataagagta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8172813 |
aagtttggcctcgatagcaaaagaaaaacgttttttgtttacataattcactattttattaaaaatgataagagta |
8172738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 70 - 102
Target Start/End: Original strand, 26368145 - 26368177
Alignment:
| Q |
70 |
ttgtttacataattcactattttattaaaaatg |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
26368145 |
ttgtttacacaattcactattttattaaaaatg |
26368177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University