View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2134_low_5 (Length: 257)
Name: NF2134_low_5
Description: NF2134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2134_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 45438389 - 45438620
Alignment:
| Q |
13 |
gagacaaaagggtatagaccctgtcactcataaaccactttctgaggtagaaaatgttgatgaggaggagggaaaaactagaagccaagagaaaacagca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45438389 |
gagacaaaagggtatagaccctgtcactcataaaccactttctgaggtagaaaatgttgatgaggaggagggaaaaactagaagccaagagaaaacagca |
45438488 |
T |
 |
| Q |
113 |
gaaatatcagaatcagatgaattgaacattgtgagatcagaaagtacttctaaatcagatgctgtttcctatgaaccaaaacaatcttcaattgtcctaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45438489 |
gaaatatcagaatcagatgaattgaacattgtgagatcagaaagtacttctaaatcagatgctgtttcatatgaaccaaaacaatcttcaattgtcctaa |
45438588 |
T |
 |
| Q |
213 |
aaggttatgcgactgaaatggaagtggaaggt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45438589 |
aaggttatgcgactgaaatggaagtggaaggt |
45438620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University