View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21350_low_2 (Length: 347)
Name: NF21350_low_2
Description: NF21350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21350_low_2 |
 | |
|
| [»] scaffold0219 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 234
Target Start/End: Complemental strand, 13780 - 13566
Alignment:
| Q |
20 |
ttaaacaacttataagaaaacaactttttatacaaataattttctgaatcattttttctatgaataggttgaattgatgtcgaactcaagctatctacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13780 |
ttaaacaacttataagaaaacaactttttatacaaataattttctgaatcattttttctatgaataggttgaattgatgtcgaactcaagctatctacaa |
13681 |
T |
|
| Q |
120 |
attgatggaacacagtatgaacttctacagttccattggcatactccatctgaacacaccattaatggtgtaaggtacatacttattgtatacccttaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13680 |
attgatggaacacagtatgaacttctacagttccattggcatactccatctgaacacaccatcaatggtgtaaggtacatacttactgtatacccttaat |
13581 |
T |
|
| Q |
220 |
tcatgataattatat |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13580 |
tcatgataattatat |
13566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 78 - 203
Target Start/End: Complemental strand, 24987 - 24862
Alignment:
| Q |
78 |
tatgaataggttgaattgatgtcgaactcaagctatctacaaattgatggaacacagtatgaacttctacagttccattggcatactccatctgaacaca |
177 |
Q |
| |
|
||||||||| | |||||||| | ||||||||||||||||||||| ||||||| ||||||| |||| |||||| ||||||||| |||| |||||||||| |
|
|
| T |
24987 |
tatgaatagctggaattgattgcaaactcaagctatctacaaattaatggaactcagtatgtacttaaacagttacattggcattctccctctgaacaca |
24888 |
T |
|
| Q |
178 |
ccattaatggtgtaaggtacatactt |
203 |
Q |
| |
|
|||| |||| ||||||||||||| |
|
|
| T |
24887 |
ccatagatggcaaaaggtacatactt |
24862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 276 - 337
Target Start/End: Complemental strand, 13514 - 13453
Alignment:
| Q |
276 |
tttgctgttggaaaatttgggcttcatgactttcttataagaaaattgttcttctacctttg |
337 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13514 |
tttgttgttagaaaatttgggcttcatgactttcttataagaaaattgttcttctacttttg |
13453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University