View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21351_high_18 (Length: 280)
Name: NF21351_high_18
Description: NF21351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21351_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 28308459 - 28308675
Alignment:
| Q |
17 |
aaattttaatgaggttgatatttgtcatttgattctaagatgcatatttaaatataa-ttttttatagtatatttaagaaaacaacaatgccagagtg-- |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28308459 |
aaattttaatgagattgatatttgtcatttgattctaagatgcatatttaaatataatttttttatagtatatttaagaaaacaacaatgccagagtgct |
28308558 |
T |
 |
| Q |
114 |
----ctcatagtctgcaaatcagtagcacatgcgaat-gggcactttccacgtgatccattcaaatggaatctactatatatatattcgggccatgctat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28308559 |
catactcatagtctgcaaatcagtagcacatgcgaatggggcactttccacgtgatccattcaaatggaatcta----ttatatatccgggccatgctat |
28308654 |
T |
 |
| Q |
209 |
gctatgttcacattgggattc |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28308655 |
gctatgttcacattgggattc |
28308675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University