View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21351_low_10 (Length: 311)
Name: NF21351_low_10
Description: NF21351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21351_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 50421377 - 50421654
Alignment:
| Q |
18 |
catcctgcaactgaagtgcaaactcaagtttctattaacacatcaccccccattgaaggacaaacaaagccattatcatctaaacccttcttaccctgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50421377 |
catcctgcaactgaagtgcaaactcaagtttccattaacaaatcaccc---attgaaggacaaacaaagccattatcacctaaacccttcttaccctgtc |
50421473 |
T |
 |
| Q |
118 |
tctacaaacttcatcaagcaattatgattaatttttacccttctttaggctcaacaaaacccaatctactgagctaacttgtgccttaagcaagctagga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50421474 |
tctacaaacttcatcaagcaattatgattaatttttacccttctttaggctcaacaaaacccaatctactaagctaacttgtgccttaagcaagctagga |
50421573 |
T |
 |
| Q |
218 |
tcaattgctgaccttgcacacaatacctcaataagcaccacagcagaagagtaaacattgttctct-aaaaagcacacagg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50421574 |
tcaattgctgaccttgcacacaatacctcaataagtaccacagcagaagagtaaacattgttctctaaaaaagcacacagg |
50421654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University