View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21351_low_20 (Length: 250)
Name: NF21351_low_20
Description: NF21351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21351_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 50421645 - 50421890
Alignment:
| Q |
1 |
agcacacaggatctaaacaaccaaaactacttttaaccattatgctaacatgagttaggtttagtttaaaaccattttccgataatctaacaccgggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50421645 |
agcacacaggatctaaacaaccaaaactacttttaaccattatgctaacatgagttaggtttagtttaaaaccattttccgataatctaacaccgggaag |
50421744 |
T |
|
| Q |
101 |
tgagaagctttcgcttcccaattttcatccaacaaaatatttgttgttttcacatcgcgatgaatgttgatggtgtattttgcaccg----gtgtgaagg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50421745 |
tgagaagctttcgcttcccaattttcatccaacaaaatatttgttgttttcacatcgcgatgaatgttgatggtgtattttgcaccggtacgtgtgaagg |
50421844 |
T |
|
| Q |
197 |
taatcaagtctctttgcagcaccaatgcaaatttccaacctttgct |
242 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50421845 |
taatcaagtctccttgcagcaccaatgcaaatttccaacctttgct |
50421890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 242
Target Start/End: Original strand, 35904623 - 35904722
Alignment:
| Q |
140 |
tttgttgttttcacatcgcgatgaatgttgatggtgtattttgcaccggtgtgaaggtaatcaagtctctttgcagcaccaatgcaaatttccaaccttt |
239 |
Q |
| |
|
||||||||||||||||| | |||||| || ||||| |||||||| ||||||||||||| ||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
35904623 |
tttgttgttttcacatctctatgaatt---atagtgtactttgcacctgtgtgaaggtaatgaagacctcttgcagcaccaatgcaaatctccaaccttt |
35904719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University