View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21351_low_22 (Length: 247)
Name: NF21351_low_22
Description: NF21351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21351_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 70 - 212
Target Start/End: Complemental strand, 9973657 - 9973515
Alignment:
| Q |
70 |
aatcatggtttttcaaaaggattgaaatataaatatttttctttcattttcaaccaaattgatgaccatctaaaatatgaaccaagccacttttatattg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9973657 |
aatcatggtttttcaaaaggattgaaatataaatatttttctttcattttcaaccaaattgatgaccatctaaaatatgaaccaagccacttttatattg |
9973558 |
T |
 |
| Q |
170 |
ttttttacttgtgatgtgtattccacttgagcttttgtgtctc |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9973557 |
ttttttacttttgatgtgtattccacttgagcttttgtgtctc |
9973515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 9973730 - 9973690
Alignment:
| Q |
18 |
atcaaaagacactatttaaagagttgtaacgggtccattgt |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9973730 |
atcaaaagacactatttaaagagttgtaacgggtccattgt |
9973690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University