View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21351_low_24 (Length: 237)
Name: NF21351_low_24
Description: NF21351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21351_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 94 - 220
Target Start/End: Complemental strand, 52387461 - 52387338
Alignment:
| Q |
94 |
attcgttattttatctagttattctaattttataaaggacactagtgtcatttgtagcgagagacgtgtgtcgagagattcaagaaaatttaggggacca |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52387461 |
attcgttattttatctagttattaaaattttataaagggcact---gttatttgtagcgagagacgtgtgtcgagagattcaagaaaatttaggggacca |
52387365 |
T |
|
| Q |
194 |
ttgacatctctgaactggccgaaaatc |
220 |
Q |
| |
|
|| |||||||||||||||||||||||| |
|
|
| T |
52387364 |
ttaacatctctgaactggccgaaaatc |
52387338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University