View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21352_low_11 (Length: 250)
Name: NF21352_low_11
Description: NF21352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21352_low_11 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 28275710 - 28275467
Alignment:
| Q |
1 |
tgaatactgtcccttgtgtgtattatcatgattaaattagacagtttgaaactttgtattccttttatactattattaccttaaggttaatcatgcatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275710 |
tgaatactgtcccttgtgtgtattatcatgattaaattagacagtttgaaactttgtattccttttatactattattaccttaaggttaatcatgcatat |
28275611 |
T |
|
| Q |
101 |
gtctatatgaaaaatcacaaacacacaaaaacatgattttaaacgcgcatgcaagcacgcgggaggttcacatgaat-ttttatatagatatgagctcaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28275610 |
gtctatatgaaaaatcacaaacacacaaaaacatgattttaaacgcgcatgcaagcacgcgggaggttcacatgaattttttatatagatatgagctcaa |
28275511 |
T |
|
| Q |
200 |
tttcattatgaaattgtcattattaattttgtttagtataatct |
243 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275510 |
ttccattatgaaattgtcattattaattttgtttagtataatct |
28275467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 184
Target Start/End: Original strand, 67715 - 67778
Alignment:
| Q |
120 |
aacacacaaaaacatgattttaaacgcgcatgcaagcacgcgggaggttcacatgaatttttata |
184 |
Q |
| |
|
||||||| |||||||| ||| |||||||| |||||||| || |||||||||| | |||||||||| |
|
|
| T |
67715 |
aacacacgaaaacatgcttt-aaacgcgcgtgcaagcatgcaggaggttcacttcaatttttata |
67778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 184
Target Start/End: Complemental strand, 40898569 - 40898506
Alignment:
| Q |
120 |
aacacacaaaaacatgattttaaacgcgcatgcaagcacgcgggaggttcacatgaatttttata |
184 |
Q |
| |
|
||||||| |||||||| ||| |||||||| |||||||| || |||||||||| | |||||||||| |
|
|
| T |
40898569 |
aacacacgaaaacatgcttt-aaacgcgcgtgcaagcatgcaggaggttcacttcaatttttata |
40898506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University