View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21352_low_12 (Length: 247)

Name: NF21352_low_12
Description: NF21352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21352_low_12
NF21352_low_12
[»] chr1 (2 HSPs)
chr1 (1-107)||(28275721-28275827)
chr1 (155-232)||(28275831-28275904)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 28275721 - 28275827
Alignment:
1 tctaggatttattaaattattcttcagtcttctcaaatttttaggttttggtctgcacatatttttaacattagtgaagctaaattaacttggtcaaact 100  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28275721 tctaggatttattaaattattcttcagtcttctctattttttaggttttggtctgcacatatttttaacattagtgaagctaaattaacttggtcaaact 28275820  T
101 gatagta 107  Q
    |||||||    
28275821 gatagta 28275827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 155 - 232
Target Start/End: Original strand, 28275831 - 28275904
Alignment:
155 ggaacttaagtaaatttggaggtgacatatcgaaggaggtcttgtgtgtggttacacagatttggacacgatatatat 232  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||    ||||||||||||||||||||||||||    
28275831 ggaacttaagtaaatttggaggtgacatatcgaaggaggtcttctgtg----tacacagatttggacacgatatatat 28275904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University