View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21352_low_12 (Length: 247)
Name: NF21352_low_12
Description: NF21352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21352_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 28275721 - 28275827
Alignment:
| Q |
1 |
tctaggatttattaaattattcttcagtcttctcaaatttttaggttttggtctgcacatatttttaacattagtgaagctaaattaacttggtcaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28275721 |
tctaggatttattaaattattcttcagtcttctctattttttaggttttggtctgcacatatttttaacattagtgaagctaaattaacttggtcaaact |
28275820 |
T |
 |
| Q |
101 |
gatagta |
107 |
Q |
| |
|
||||||| |
|
|
| T |
28275821 |
gatagta |
28275827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 155 - 232
Target Start/End: Original strand, 28275831 - 28275904
Alignment:
| Q |
155 |
ggaacttaagtaaatttggaggtgacatatcgaaggaggtcttgtgtgtggttacacagatttggacacgatatatat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
28275831 |
ggaacttaagtaaatttggaggtgacatatcgaaggaggtcttctgtg----tacacagatttggacacgatatatat |
28275904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University