View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21353_high_9 (Length: 250)
Name: NF21353_high_9
Description: NF21353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21353_high_9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 7150916 - 7150676
Alignment:
| Q |
10 |
aagaatatgatgttgttgatgaggtgcgtatgcagttgctacaacttgtagccttgtttctatgtcatggcaatcctttaattgattgcttcatcaagaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150916 |
aagaaaatgatgttgttgatgaggtgcgtatgcagttgctacaacttgtagccttgtttctatgtcatggcaatcctttaattgattgcttcatcaagaa |
7150817 |
T |
|
| Q |
110 |
gaatccttgtgtgtctgacatcgagttaaatgtaacatgcgaggctgaaagtgacaattattatggtgtcacatattttgtatctttcatacgtacggtc |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7150816 |
gaatccttgtgtgtctgacatcaggttaaatgtaacatgcgaggctgaaagcgacaattattatggtgtcacatattttgtatctttcatacgttcggtc |
7150717 |
T |
|
| Q |
210 |
agataaataaacaatactggtataaaagacaattttatgtt |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7150716 |
agataaataaacaatactagtataaaagacaattttatgtt |
7150676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University