View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21353_low_9 (Length: 262)
Name: NF21353_low_9
Description: NF21353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21353_low_9 |
 |  |
|
| [»] scaffold0721 (1 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 31437066 - 31436833
Alignment:
| Q |
18 |
gtgcttggtcacattttacaccgttccaggtgcagaagttgctgctagttgaccaacctgacggagtaggactcaaagattttgctagctttgacatgaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437066 |
gtgcttggtcacattttacaccgttccaggtgcagaagttgctgctaattgaccaacctgacggagtaggactcaaagattttgctagctttgacatgaa |
31436967 |
T |
 |
| Q |
118 |
agtgccatcgtctccaatggtcatttggagaatatagaaacttaggaacaataacacatgtttcacttttgattttgagggagccatttagatttctttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31436966 |
agtgccatcgtctccaatggtcatttggagaatatagaaacttaggaacaataacacatgtttcacttttgattttgagggagccatttagatttctttc |
31436867 |
T |
 |
| Q |
218 |
ggaaattgaggaatactagagcagaaagagtattat |
253 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |
|
|
| T |
31436866 |
ggaaattgagg--taatagagcagaaagagtattat |
31436833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0721 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0721
Description:
Target: scaffold0721; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 136
Target Start/End: Original strand, 6187 - 6256
Alignment:
| Q |
67 |
tgaccaacctgacggagtaggactcaaagattttgctagctttgacatgaaagtgccatcgtctccaatg |
136 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
6187 |
tgaccaacctgatggtgtaggactcaaggattttgccagctttgacatgaaagtgccatcatctgcaatg |
6256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 136
Target Start/End: Original strand, 2706 - 2775
Alignment:
| Q |
67 |
tgaccaacctgacggagtaggactcaaagattttgctagctttgacatgaaagtgccatcgtctccaatg |
136 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
2706 |
tgaccaacctgatggtgtaggactcaaggattttgccagctttgacatgaaagtgccatcatctgcaatg |
2775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 136
Target Start/End: Complemental strand, 15061353 - 15061284
Alignment:
| Q |
67 |
tgaccaacctgacggagtaggactcaaagattttgctagctttgacatgaaagtgccatcgtctccaatg |
136 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
15061353 |
tgaccaacctgatggtgtaggactcaaggattttgccagctttgacatgaaagtgccatcatctgcaatg |
15061284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University