View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21355_high_13 (Length: 250)

Name: NF21355_high_13
Description: NF21355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21355_high_13
NF21355_high_13
[»] chr2 (2 HSPs)
chr2 (172-233)||(4709081-4709142)
chr2 (178-233)||(4747026-4747081)


Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 172 - 233
Target Start/End: Complemental strand, 4709142 - 4709081
Alignment:
172 gcgctactatgcatgggcttcacactggattatatgttatattggttgagtaatggtgggtt 233  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
4709142 gcgctactatgcatgagcttcacactggattatatgttatattggttgagtaatggtgggtt 4709081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 233
Target Start/End: Complemental strand, 4747081 - 4747026
Alignment:
178 ctatgcatgggcttcacactggattatatgttatattggttgagtaatggtgggtt 233  Q
    ||||||||| ||||||||||| ||||| |||| ||||| |||||||||| ||||||    
4747081 ctatgcatgagcttcacactgtattatctgttttattgattgagtaatgttgggtt 4747026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University