View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21355_low_10 (Length: 311)
Name: NF21355_low_10
Description: NF21355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21355_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 168 - 295
Target Start/End: Original strand, 36510365 - 36510492
Alignment:
| Q |
168 |
atttgttccacaataaaagtcacatttgcaaaagaaattatcacaaaacaaacctgggctaatgtaatacccttcttgtctcaacatacgaaattgaaat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36510365 |
atttgttccacaataaaagtcacatttgcaaaagaaattatcacaaaacaaacctgggctaatgtaatacccttcttgtctcaacatacgaaattgaaat |
36510464 |
T |
 |
| Q |
268 |
gcagcttgtgacagtccttgatattcat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36510465 |
gcagcttgtgacagtccttgatattcat |
36510492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 16 - 120
Target Start/End: Original strand, 36510245 - 36510349
Alignment:
| Q |
16 |
catttatatcctcagaaaatgtatgcttgagtttgcctttgttgtcacagaacttatcaaatatgtctgtaagatgcagcaaaaaacattgtcatgttca |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36510245 |
catttatatcctcagaaaatgtatacttgagtttgcctttgttgtcacaaaacttatcaaatatgtctgtaagatgcagcaaaaaacatggtcatgttca |
36510344 |
T |
 |
| Q |
116 |
tgtag |
120 |
Q |
| |
|
||||| |
|
|
| T |
36510345 |
tgtag |
36510349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 226 - 292
Target Start/End: Complemental strand, 37343140 - 37343074
Alignment:
| Q |
226 |
ctaatgtaatacccttcttgtctcaacatacgaaattgaaatgcagcttgtgacagtccttgatatt |
292 |
Q |
| |
|
||||||||||||| || |||||| ||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
37343140 |
ctaatgtaataccttttttgtcttaacatacgaaattgaaatgcaacttgtgacagtccttcatatt |
37343074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University