View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21355_low_15 (Length: 250)
Name: NF21355_low_15
Description: NF21355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21355_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 172 - 233
Target Start/End: Complemental strand, 4709142 - 4709081
Alignment:
| Q |
172 |
gcgctactatgcatgggcttcacactggattatatgttatattggttgagtaatggtgggtt |
233 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4709142 |
gcgctactatgcatgagcttcacactggattatatgttatattggttgagtaatggtgggtt |
4709081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 178 - 233
Target Start/End: Complemental strand, 4747081 - 4747026
Alignment:
| Q |
178 |
ctatgcatgggcttcacactggattatatgttatattggttgagtaatggtgggtt |
233 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||| ||||| |||||||||| |||||| |
|
|
| T |
4747081 |
ctatgcatgagcttcacactgtattatctgttttattgattgagtaatgttgggtt |
4747026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University