View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21356_high_17 (Length: 294)
Name: NF21356_high_17
Description: NF21356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21356_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 278
Target Start/End: Complemental strand, 23988128 - 23987860
Alignment:
| Q |
10 |
ttatacttgtccttgcattagaagccacccctttgatccagtttttgttgcgcaatcaaacgggaattatgttgcaatctttagtaccaccccgccatac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23988128 |
ttatacttgtccttgcattagaagccacccctttgatccagtttttgttgcgcaatcaaacgggaattatgttgcaatctttagtaccaccccgccatac |
23988029 |
T |
|
| Q |
110 |
agactgaacaaatataagagatatgagaaccatggggtttctgggttcccaattaagtgcaatttcagcttagatgggaagaagcttgcatctggctctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23988028 |
agactgaacaaatataagagatatgagaaccatggggtttctgggttcccaattaagtgcaatttcagcttagatgggaagaagcttgcatctggctctt |
23987929 |
T |
|
| Q |
210 |
cagatggatctatttacctttatgattatcagtcatccaaagttttgaagaaaataaaggcctttaacc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23987928 |
cagatggatctatttacctttatgattatcagtcatccaaagttttgaagaaaataaaggcctttaacc |
23987860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 10 - 278
Target Start/End: Original strand, 23932823 - 23933091
Alignment:
| Q |
10 |
ttatacttgtccttgcattagaagccacccctttgatccagtttttgttgcgcaatcaaacgggaattatgttgcaatctttagtaccaccccgccatac |
109 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23932823 |
ttatacttgttcttgcattagaattcacccctttgatccagtttttgtcgcgcaatcaaacgggaattatgttgcaatctttagtaccaccccgccatac |
23932922 |
T |
|
| Q |
110 |
agactgaacaaatataagagatatgagaaccatggggtttctgggttcccaattaagtgcaatttcagcttagatgggaagaagcttgcatctggctctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23932923 |
agactgaacaaatataagagatatgagaaccatggggtttctgggttcccaattaagtgcaatttcagcttagatgggaagaagcttgtatctggctctt |
23933022 |
T |
|
| Q |
210 |
cagatggatctatttacctttatgattatcagtcatccaaagttttgaagaaaataaaggcctttaacc |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23933023 |
cagatggatctatttacctttatgattatcagtcatccaaagttttgaagaaaataaaggcctttaacc |
23933091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University