View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21356_low_20 (Length: 257)
Name: NF21356_low_20
Description: NF21356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21356_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 13628748 - 13628978
Alignment:
| Q |
19 |
gtcgtgcaccaagagaaaagctacaaatacatcaaacaaatattcatttttatgatcaagctataaatagaaaatgtattgtgcta----tagcactgct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13628748 |
gtcgtgcaccaagagaaaagctacaaatacatcaaacaaatattcatttttatgatcaagctataaatagaaaatgtattgtgctagctatagcactgct |
13628847 |
T |
 |
| Q |
115 |
atttatcaacactgactaataatcttatggaggttacggttagacatacctgagcatcagcatctgaagttaccattgtactcagtcgaggagaaaacac |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13628848 |
atttatcaacactgactaataatcttacggaggttacggttagacatacctgagcatcagcatctgaagttaccattgtattcagtcgaggagaaaacac |
13628947 |
T |
 |
| Q |
215 |
tataccagtgatgtgtttttggtgacccctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13628948 |
tataccagtgatgtgtttttggtgacccctt |
13628978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 13684810 - 13684902
Alignment:
| Q |
150 |
acggttagacatacctgagcatcagcatctgaagttaccattgtactcagtcgaggagaaaacactataccagtgatgtgtttttggtgaccc |
242 |
Q |
| |
|
||||||| |||||||||||||||||| | |||| |||||| || ||||| |||||||||| ||||||||||| |||| ||| |||||||| |
|
|
| T |
13684810 |
acggttaaacatacctgagcatcagcgcccgaagaaaccattatattcagttgaggagaaaatactataccagtaatgtactttcggtgaccc |
13684902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University