View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21356_low_4 (Length: 457)
Name: NF21356_low_4
Description: NF21356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21356_low_4 |
 |  |
|
| [»] chr4 (144 HSPs) |
 |  |
|
| [»] chr2 (116 HSPs) |
 |  |
|
| [»] chr7 (116 HSPs) |
 |  |
|
| [»] chr5 (98 HSPs) |
 |  |
|
| [»] chr1 (144 HSPs) |
 |  |
|
| [»] chr8 (117 HSPs) |
 |  |
|
| [»] chr6 (87 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold1619 (1 HSPs) |
 |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (3 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
| [»] scaffold1120 (1 HSPs) |
 |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |
|
| [»] scaffold1379 (1 HSPs) |
 |  |
|
| [»] scaffold1149 (1 HSPs) |
 |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 122)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 88 - 242
Target Start/End: Complemental strand, 34899489 - 34899335
Alignment:
| Q |
88 |
cgaaaaagagatcccaataaatacaagttgagtttaagaaggatccaaatagcaccacaagaaacaattagagaagtgtcaaaacaaaagggnnnnnnnn |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899489 |
cgaaaaagagatcccaataaatacaagttgagtttaagaaggatccaaatagcaccacaagaaacaattagagaagtgtcaaaacaaaagggaaaaaaaa |
34899390 |
T |
 |
| Q |
188 |
ttcattgatgaattgtatagccctgatttttaaaattgagcaagactcttctgat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34899389 |
ttcattgatgaattgtatagccctgatttttagaattgagcaagactcttctgat |
34899335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 283 - 457
Target Start/End: Complemental strand, 34899294 - 34899121
Alignment:
| Q |
283 |
tactataataactagttttttacaaggttaaaataaacgtatctgtaaacttatgttgaaattttacaaatgtagagccattttatttttattaaacgat |
382 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34899294 |
tactataataaccagttttttacgaggttaaaataaacgtatctgtaaacttatgttgaaattttataaatgtagaaccattctatttttattaaacgat |
34899195 |
T |
 |
| Q |
383 |
gttcggcaactatgtgannnnnnnnngttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899194 |
gttcggcaactatgtga-ttttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
34899121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 22 - 93
Target Start/End: Original strand, 34899527 - 34899598
Alignment:
| Q |
22 |
tatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899527 |
tatgaagaagtgtctgctaagacttacaaataattagttggtagctgaatgcagaaaattgaatatcgaaaa |
34899598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 7464482 - 7464528
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7464482 |
tggtggtcggggtttgaaccccggaccttacatatattatgcattgt |
7464528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 25727958 - 25728004
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25727958 |
tggtggtcgggatttgaaccccggaccttgcatatattatgcattgt |
25728004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 38130950 - 38130996
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38130950 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
38130996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 48849754 - 48849800
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48849754 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
48849800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 4601914 - 4601868
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4601914 |
tggtggccggggtttgaaccccggaccttgcatttattatgcattgt |
4601868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 10922299 - 10922345
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10922299 |
tggtagtcggggtttgaaccccggatcttgcatatattatgcattgt |
10922345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 22722472 - 22722426
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
22722472 |
tggtggtcggggtttgaacctcggaccttgcatattttatgcattgt |
22722426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 25340915 - 25340961
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25340915 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
25340961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 25441491 - 25441537
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25441491 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
25441537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 39779094 - 39779048
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcattgt |
39779048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 45334259 - 45334213
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45334259 |
tggtggtcgggatttgaaccccgaaccttgcatatattatgcattgt |
45334213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 45432018 - 45431972
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45432018 |
tggtggccagggtttgaaccccggaccttgcatatattatgcattgt |
45431972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 48315017 - 48315059
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcatt |
48315059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 41817560 - 41817523
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41817560 |
gggtttgaaccccggaccttgcatatattatgcattgt |
41817523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 334838 - 334882
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
334838 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 1111834 - 1111878
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1111834 |
gtggtcggggtttgaaccccagaccttgcatatattatgtattgt |
1111878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 48656900 - 48656936
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgt |
48656936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 421 - 456
Target Start/End: Original strand, 913601 - 913636
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
913601 |
ggtttgaaccccggaccttgcatatattatgcattg |
913636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 411 - 454
Target Start/End: Original strand, 8136623 - 8136666
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8136623 |
tggtggtcggggtttgaaccttggaccttgcatatattatgcat |
8136666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 420 - 455
Target Start/End: Original strand, 16663236 - 16663271
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcatt |
16663271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 16792972 - 16793011
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16792972 |
cggggtttgaaccctggaccttgcatatattatgcattgt |
16793011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 46226015 - 46226062
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
46226015 |
ttggtgttcggggttcgaactccggaccttgcatatattatgcattgt |
46226062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 49082703 - 49082746
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
49082703 |
tggtcggggtttgaaccccggaccttgcatatatcatacattgt |
49082746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 415 - 453
Target Start/End: Complemental strand, 552240 - 552202
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
552240 |
ggtcggggtttgaaccctggaccttgcatatattatgca |
552202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 916509 - 916463
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
916509 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
916463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 4332660 - 4332702
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
4332660 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
4332702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 4825409 - 4825363
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4825409 |
tggtggtcgaggttcgaaccccggacctttcatatattatgcattgt |
4825363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8075855 - 8075809
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8075855 |
tggtggccggggtttgaacctcagaccttgcatatattatgcattgt |
8075809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8238634 - 8238588
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8238634 |
tggtggccggagtttgaaccccagaccttgcatatattatgcattgt |
8238588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 11358304 - 11358258
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
11358304 |
tggtggccggggtttgaaccccggatcttgcatatattatgaattgt |
11358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 27185547 - 27185501
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
27185547 |
tggtggtcgaggtttgaaccccagaccttgcatatattatgtattgt |
27185501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28244095 - 28244141
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
28244095 |
tggtgatcggggttcgaaccccggaccttgcatattttatgcattgt |
28244141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29631256 - 29631210
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
29631256 |
tggtggccggggtttgaatcccgaaccttgcatatattatgcattgt |
29631210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 32843253 - 32843299
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32843253 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgt |
32843299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 35347288 - 35347330
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcatt |
35347330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 40575612 - 40575646
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcattgt |
40575646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 44075147 - 44075193
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44075147 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
44075193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 48022305 - 48022351
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
48022305 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgt |
48022351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 48796209 - 48796255
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
48796209 |
tggtggccggggtttgaaccccgaaccttgcatatcttatgcattgt |
48796255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 51882191 - 51882237
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
51882191 |
tggtggccggggtttgaaccctggatcttgcatatattatgcattgt |
51882237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 52119446 - 52119400
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgt |
52119400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 411 - 452
Target Start/End: Original strand, 51812576 - 51812617
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
452 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
51812576 |
tggtggtcgtggtttgaaccccgtaccttgcatatattatgc |
51812617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 986946 - 986990
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| |||||| |
|
|
| T |
986946 |
gtggtcggggtttgaaccctggaccttgcatattttatacattgt |
986990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 11508476 - 11508520
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
11508476 |
gtggtcggggttcgaaccccggaccctgcatatatcatgcattgt |
11508520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 20612270 - 20612314
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20612270 |
gtggccggggtttgaaccccaaaccttgcatatattatgcattgt |
20612314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 22251451 - 22251495
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
22251451 |
tggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 24348455 - 24348411
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24348455 |
gtggtcggagtttgaacctctgaccttgcatatattatgcattgt |
24348411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 29164744 - 29164788
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
29164744 |
tggtggtcggggtttgaaccccagactttgcatatattatacatt |
29164788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 31214704 - 31214660
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31214704 |
tggtggtcggagtttgaatcccggaccttacatatattatgcatt |
31214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 34442440 - 34442484
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacatattttatgcattgt |
34442484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 2186421 - 2186464
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
2186421 |
tggtcggggtttgaaccccagaccttacatatattatgtattgt |
2186464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 7626463 - 7626498
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7626463 |
gtttgaaccccggaccttgcatattttatgcattgt |
7626498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 7738732 - 7738693
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
7738732 |
cggggcttgaaccccggaccttgcatattttatgcattgt |
7738693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 14160276 - 14160315
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
14160276 |
cggggttcgaaccccggactttgcatatattatgcattgt |
14160315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 449
Target Start/End: Original strand, 17589508 - 17589547
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatatta |
449 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17589508 |
ttggtggtcggggtttgaactccgcaccttgcatatatta |
17589547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 21245860 - 21245817
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
21245860 |
tggtcgaggtttgaaccccagaccttacatatattatgcattgt |
21245817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Complemental strand, 28266771 - 28266740
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcattgt |
28266740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 28965775 - 28965814
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
28965775 |
cggggtttgaaccccgaaccttacatatattatgcattgt |
28965814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 30554869 - 30554912
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||||| |
|
|
| T |
30554869 |
tggtcggggtttgaaccctgaaccttgcatatagtatgcattgt |
30554912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 44579699 - 44579660
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
44579699 |
cggggttcgaaccccggaccttgcatattttatgcattgt |
44579660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 49975807 - 49975842
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49975807 |
gtttgaaccccagaccttgcatatattatgcattgt |
49975842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 51047160 - 51047207
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
51047160 |
tggtggtcggggtttgaaccccggaccttacatattattatacattgt |
51047207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 52904141 - 52904180
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
52904141 |
cggggtttgaacccccgacattgcatatattatgcattgt |
52904180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 977944 - 977978
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgt |
977978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 2153492 - 2153538
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | |||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
2153492 |
tggtggccagggtttaaaccccagaccttgcatatattatgcattgt |
2153538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 3755409 - 3755363
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
3755409 |
tggtggccgaggtttaaaccctggaccttgcatatattatgcattgt |
3755363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 5349598 - 5349552
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
5349598 |
tggtggccagggtttgaacctcggaccttgcatatataatgcattgt |
5349552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 453
Target Start/End: Original strand, 6835842 - 6835884
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
6835842 |
tggtggtcggggttcgaaccctagaccttgcatatattatgca |
6835884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Complemental strand, 10926527 - 10926493
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcattgt |
10926493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 13829076 - 13829114
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
13829114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14030726 - 14030772
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
14030726 |
tggtggtcggggtttgaactccaaaccttgcatatattatgcgttgt |
14030772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 14827595 - 14827549
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| ||||||||| ||||||||| ||||||||||| |
|
|
| T |
14827595 |
tggtggccggggtttaaaccccggatcttgcatattttatgcattgt |
14827549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20296364 - 20296318
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
20296364 |
tggtcgtcggggtttgaacatcggactttgcatatattatgcattgt |
20296318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 21628881 - 21628923
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
21628881 |
gtggtcggagtttgaaccccggacgttggatatattatgcatt |
21628923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 22799717 - 22799763
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
22799717 |
tggtggtcgaggtttgaacctcggaccttgcatgttttatgcattgt |
22799763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23147969 - 23148015
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||| ||||||||||||| |||||||||||| ||||| |
|
|
| T |
23147969 |
tggtgttcggggttcgaaccccggacctcgcatatattatgtattgt |
23148015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 26768471 - 26768425
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| | | |||||||||||| ||||||||||| |
|
|
| T |
26768471 |
tggtggtcggggtttgaagctcagaccttgcatattttatgcattgt |
26768425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 27065731 - 27065769
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
27065731 |
ggggtttgaaccctggaccttgcatattttatgcattgt |
27065769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28430556 - 28430602
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| | ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
28430556 |
tggtggtcagagtttgaacctcagaccttgcatatattatgcattgt |
28430602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32629150 - 32629104
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
32629150 |
tggtggtcgatgttcgaaccccggaccttgcatattttatgcattgt |
32629104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 32909292 - 32909338
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32909292 |
tggtggccgggatttgaacccaggaccttgcatattttatgcattgt |
32909338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 33745161 - 33745123
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
33745161 |
ggggtttgaaccccagaccttgcatattttatgcattgt |
33745123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 35191816 - 35191854
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
35191816 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
35191854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35863804 - 35863850
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
35863804 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgt |
35863850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 412 - 450
Target Start/End: Complemental strand, 38798929 - 38798891
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
38798929 |
ggtggtcgggatttgaacctcggaccttgcatatattat |
38798891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 42372588 - 42372546
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
42372588 |
gtggtcggagtttgaaccccggaccttggatatatcatgcatt |
42372546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 456
Target Start/End: Complemental strand, 44582795 - 44582749
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattg |
456 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
44582795 |
tggtggccggggttcgaaccccggaccttgcatattattatgcattg |
44582749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 453
Target Start/End: Original strand, 45885468 - 45885510
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
45885468 |
tggtggccggggtttgaacctcagaccttgcatatattatgca |
45885510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 46093186 - 46093140
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| |||| | ||||||||||||||||||||||| |
|
|
| T |
46093186 |
tggtggtcggggtttaaaccacaaaccttgcatatattatgcattgt |
46093140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 46298048 - 46298090
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
46298048 |
gtggtcagggtttgaacctcggacattgcatatattatgcatt |
46298090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 47039497 - 47039451
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
47039497 |
tggtggtcgggattcgaaccccgaactttgcatatattatgcattgt |
47039451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 47099028 - 47099070
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
47099028 |
gtggttgggatttgaaccccgaaccttgcatatattatgcatt |
47099070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 52576017 - 52575971
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||| ||||||||||| |
|
|
| T |
52576017 |
tggtggtcgggattcgaaccccagaccttgcatattttatgcattgt |
52575971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 53996369 - 53996323
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
53996369 |
tggtggccgggattcgaaccccagaccttgcatatattatgcattgt |
53996323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 24428473 - 24428510
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
24428473 |
gggtttgaacctcggactttgcatatattatgcattgt |
24428510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 25505701 - 25505738
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
25505701 |
gggttcgaaccccagaccttgcatatattatgcattgt |
25505738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 452
Target Start/End: Original strand, 35210122 - 35210163
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
452 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
35210122 |
tggtggccgaggtttgaaccccggaccttgcatattttatgc |
35210163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 88606 - 88642
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
88606 |
ggtttgaaccccggactttgcatatattatgtattgt |
88642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 3582852 - 3582808
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
3582852 |
tggtggtcatggtttgaacctcggaccttgcatattttatgcatt |
3582808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 5428437 - 5428473
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
5428437 |
ggtttgaatcctggaccttgcatatattatgcattgt |
5428473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 7300842 - 7300802
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
7300842 |
tggtggtcggggttcgaatcccgaaccttgcatatattatg |
7300802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 9598507 - 9598463
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| |||| |||||| |
|
|
| T |
9598507 |
gtggtcggggtttgaatctcggaccttgcatattttatacattgt |
9598463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 16873856 - 16873812
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
16873856 |
tggtgatcgaggtttgaacccctaaccttgcatatattatgcatt |
16873812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 16980347 - 16980391
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
16980347 |
gtggtcgggatttgaaccatgaaccttgcatatattatgcattgt |
16980391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 19880288 - 19880248
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
19880288 |
tcggggtttgaactccgaaccttgcatttattatgcattgt |
19880248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 20018257 - 20018221
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
20018257 |
ggtttgaaccccagaccttgcatattttatgcattgt |
20018221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 454
Target Start/End: Original strand, 20906479 - 20906515
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatat-attatgcat |
454 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20906479 |
ggggtttgaaccccggaccttgcatataattatgcat |
20906515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 455
Target Start/End: Complemental strand, 21160114 - 21160078
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
21160114 |
ggggtttgaacccccgaccttacatatattatgcatt |
21160078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 24120411 - 24120455
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||| |||| ||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24120411 |
tggtgatcggagtttgaaccgcggatcttgcatatattatgcatt |
24120455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 25730472 - 25730428
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
25730472 |
tggtggccggggttcgaaccccagaccttgtatatattatgcatt |
25730428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 38034810 - 38034846
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
38034810 |
ggtttgaaccccggaccttgcatattttatgtattgt |
38034846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 38603028 - 38602984
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
38603028 |
tggtggccggggtttgaaccatgaaccttgcatatattatgcatt |
38602984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 40520822 - 40520778
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
40520822 |
tggtggtcggggtttgaactttggaccttgcatattttatgcatt |
40520778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 42886510 - 42886546
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
42886510 |
ggtttgaaccccgaaccttgcatattttatgcattgt |
42886546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 429 - 457
Target Start/End: Complemental strand, 48511302 - 48511274
Alignment:
| Q |
429 |
ccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48511302 |
ccccggaccttgcatatattatgcattgt |
48511274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 52456551 - 52456507
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
52456551 |
tggtggtcagggttcgaaccccggaccttacatattttatgcatt |
52456507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 52491521 - 52491477
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
52491521 |
tggtcgtcggggttcgaacagcggaccttgcatatattatgcatt |
52491477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 420 - 456
Target Start/End: Complemental strand, 53208031 - 53207995
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
53208031 |
gggttcgaaccccagaccttgcatatattatgcattg |
53207995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 55066591 - 55066635
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
55066591 |
tggtggccgggatttgaaccccagaccatgcatatattatgcatt |
55066635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 144)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11949754 - 11949800
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11949754 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
11949800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19479468 - 19479514
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19479514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 9946497 - 9946451
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9946497 |
tggtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
9946451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 21114296 - 21114342
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21114296 |
tggtggtcggggtttgaaccccggaccttgcatatatcatgcattgt |
21114342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 49041972 - 49042018
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041972 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
49042018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 409 - 457
Target Start/End: Original strand, 22164258 - 22164306
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
22164258 |
gttggtggtcggggtttgaaccccagaccttacatatattatgcattgt |
22164306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 24664982 - 24665026
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24664982 |
tggtggtcggggttcgaaccccggaccttgcatatattatgcatt |
24665026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 675980 - 675942
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
675942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 3936697 - 3936651
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3936697 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 7230350 - 7230304
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7230350 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgt |
7230304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 11198398 - 11198352
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11198398 |
tggtggccggggtttgaaccccggaccttgcatatattatgccttgt |
11198352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 14202472 - 14202514
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcatt |
14202514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 453
Target Start/End: Complemental strand, 17729496 - 17729454
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17729496 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
17729454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 19908762 - 19908716
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
19908762 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattgt |
19908716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 20383550 - 20383512
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20383550 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
20383512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 21318244 - 21318290
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21318244 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcattgt |
21318290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 22630351 - 22630397
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgt |
22630397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 24079831 - 24079877
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24079831 |
tggtggtcggggtttgaactccggaccttgcatattttatgcattgt |
24079877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 37930838 - 37930884
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
37930838 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgt |
37930884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 42845095 - 42845049
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42845095 |
tggtggtcggagttttaaccccggaccttgcatatattatgcattgt |
42845049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 54857606 - 54857652
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54857606 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
54857652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 56551583 - 56551629
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
56551583 |
tggtggccggggtttgaacctcggaccttgcatatattatgcattgt |
56551629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 20799394 - 20799431
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20799394 |
gggtttgaaccccggaccttgcatatattatgcattgt |
20799431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 411 - 456
Target Start/End: Complemental strand, 34042310 - 34042265
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34042310 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattg |
34042265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 418 - 455
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 418 - 455
Target Start/End: Original strand, 54294420 - 54294457
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54294420 |
cggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 8027388 - 8027432
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
8027388 |
tggtggtcggggtttgaacccccgatcttgcatatattatgcatt |
8027432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 17423179 - 17423214
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcattgt |
17423214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 25783451 - 25783486
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcattgt |
25783486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 37921809 - 37921770
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37921809 |
cggggtttgaatcccggaccttgcatatattatgcattgt |
37921770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 40070962 - 40071005
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40070962 |
tggtcggggtttgaacttcggaccttgcatatattatgcattgt |
40071005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 43782295 - 43782342
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43782295 |
ttggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgt |
43782342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 49953405 - 49953440
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcattgt |
49953440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 836226 - 836272
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
836226 |
tggtggtcggagtttgaacctcggaccttgcatatattttgcattgt |
836272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 5924719 - 5924673
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
5924719 |
tggtggtcgaggtttgaaccccggaccttccatatattatgtattgt |
5924673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 6610331 - 6610289
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6610331 |
gtggtcggggtttgaaccccagaccttgcatatattatacatt |
6610289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 10261760 - 10261806
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
10261760 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
10261806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16304089 - 16304135
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgt |
16304135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 16470374 - 16470328
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
16470374 |
tggtggtcggggttcgaaccctggaccttgcatattttatgcattgt |
16470328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 19588224 - 19588178
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
19588224 |
tggtggccggggtttgaaccctggaccttgcatattttatgcattgt |
19588178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19997355 - 19997401
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
19997355 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgt |
19997401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 21317329 - 21317375
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21317329 |
tggtggttgaggtttgaacccctgaccttgcatatattatgcattgt |
21317375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 21562695 - 21562649
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
21562695 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
21562649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 23775588 - 23775542
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
23775588 |
tggtggttggggttcgaaccctggaccttgcatatattatgcattgt |
23775542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 26926701 - 26926747
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
26926701 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
26926747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 28435247 - 28435285
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28435247 |
ggggtttgaaccccgaaccttgcatatattatgcattgt |
28435285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29908126 - 29908080
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29908126 |
tggtgatcgaggtttgaactccggaccttgcatatattatgcattgt |
29908080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35287498 - 35287544
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
35287498 |
tggtggccggggttggaaccccggaccttgcatattttatgcattgt |
35287544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 36490638 - 36490592
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
36490638 |
tggtggtcgggatttgaaccccggatcttgcatacattatgcattgt |
36490592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 38375027 - 38374981
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
38375027 |
tggtggccggggtttgaactccagaccttgcatatattatgcattgt |
38374981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 43034333 - 43034379
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43034333 |
tggtggccggggtttgaacctcagaccttgcatatattatgcattgt |
43034379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 43330216 - 43330170
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
43330216 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
43330170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 47015559 - 47015605
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
47015559 |
tggtggtcggagtttgaaccccagaccttgtatatattatgcattgt |
47015605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 47806247 - 47806293
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
47806247 |
tggtgttcggggttcgaaccccagaccttgcatatattatgcattgt |
47806293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 451
Target Start/End: Original strand, 47814244 - 47814282
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatg |
47814282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 49473707 - 49473669
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49473707 |
ggggttcgaaccccggaccttgcatatattatgcattgt |
49473669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 51450282 - 51450236
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
51450282 |
tggtggccggggtttgaactccggaccttgcatatcttatgcattgt |
51450236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 54500639 - 54500593
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54500639 |
tggtggtcagtgtttgaaccccggaccttacatatattatgcattgt |
54500593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 55061107 - 55061061
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
55061107 |
tggtggtcggaatttgaacccccgaccttgcatatattatgcattgt |
55061061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 22040711 - 22040674
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgt |
22040674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 415 - 456
Target Start/End: Original strand, 30850379 - 30850420
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
30850379 |
ggtcggggtttgaaccctgaaccttgcatatattatgcattg |
30850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 42139913 - 42139868
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgt |
42139868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 43722826 - 43722789
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcattgt |
43722789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 281651 - 281615
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
281651 |
ggtttgaaccccggacctttcatatattatgcattgt |
281615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 2888944 - 2888900
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2888944 |
tggtggccggggtttgaaccgcggaccttgcatatattatacatt |
2888900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 419 - 455
Target Start/End: Complemental strand, 6087809 - 6087773
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6087809 |
ggggtttgaaccccagaccttgcatatattatgcatt |
6087773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Original strand, 7371537 - 7371585
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
7371537 |
gttggtgtccggggttcgaaccccggaccttgcatatattatgtattgt |
7371585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 10035335 - 10035295
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
10035335 |
tggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 12322733 - 12322697
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgt |
12322697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 16737139 - 16737095
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
16737139 |
gtggttgggatttgaacccccgaccttgcatatattatgcattgt |
16737095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 18903749 - 18903793
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
18903749 |
tggtggtcagggtttgaaccccagaccttacatatattatgcatt |
18903793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 415 - 455
Target Start/End: Complemental strand, 36035900 - 36035860
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
36035900 |
ggtcggagtttgaaccccggaccttggatatattatgcatt |
36035860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 37800903 - 37800855
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
37800903 |
gttggtgatcggggttcgaaccccagacctcgcatatattatgcattgt |
37800855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 43374265 - 43374309
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcatattttatgcattgt |
43374309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 48226760 - 48226716
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48226760 |
gtggccggagtttgaaccccggaccttgcatattttatgcattgt |
48226716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 418 - 454
Target Start/End: Original strand, 50152236 - 50152272
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50152236 |
cggggtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 50362140 - 50362176
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcattgt |
50362176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 415 - 455
Target Start/End: Original strand, 52869004 - 52869044
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
52869004 |
ggtcggggtttgaactccggaccttgtatatattatgcatt |
52869044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 1753350 - 1753389
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
1753350 |
cggggtttgaacccccgaccttgcatatgttatgcattgt |
1753389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 14577505 - 14577544
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
14577505 |
cggggtttgaactccggactttgcatatattatgcattgt |
14577544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 15583632 - 15583593
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
15583632 |
tggtggtcagggtttgaatcccggaccttgcatatattat |
15583593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 16431679 - 16431640
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
16431679 |
cggggtttgaaccccagaccttgcatattttatgcattgt |
16431640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Complemental strand, 18094475 - 18094432
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
18094475 |
tggtggttagggtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 18915036 - 18915083
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| || |||||||||||| || |||||||||||||||| |
|
|
| T |
18915036 |
ttggtggtcgggattcgaaccccggaccatgaatatattatgcattgt |
18915083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 19840030 - 19839991
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
19840030 |
tggtggtcgtggtttggaccccggaccttgcatatattat |
19839991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 25115116 - 25115073
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
25115116 |
tggtcggggtttgaaccctgaaccttgcatatgttatgcattgt |
25115073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 29701159 - 29701112
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
29701159 |
ttggtggccggagtttgaaccccggaacttgcatatattatacattgt |
29701112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 31138991 - 31139030
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
31138991 |
cggggtttgaacctcggaccttgcatattttatgcattgt |
31139030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Original strand, 34834012 - 34834043
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34834012 |
gaaccccggaccttgcatatattatgcattgt |
34834043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 37193308 - 37193273
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37193308 |
gtttgaaccccggaccttgcatatattatacattgt |
37193273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 41521025 - 41520978
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41521025 |
ttggtggtcggagtttgaaccttgaaccttgcatatattatgcattgt |
41520978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Original strand, 46676504 - 46676535
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcattgt |
46676535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 49952571 - 49952606
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49952571 |
gtttgaaccccggaccttacatatattatgcattgt |
49952606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 897487 - 897449
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
897487 |
ggggtttgaaccccggaccttacatatattatacattgt |
897449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8607197 - 8607151
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||| ||||||||| |||| |||||||||||| |
|
|
| T |
8607197 |
tggtagtcggggtttgaactccggaccttacatacattatgcattgt |
8607151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 10336977 - 10337023
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
10336977 |
tggtgttcggggtttgaaccccgaaccttacatacattatgcattgt |
10337023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11085756 - 11085802
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||| | || ||||||||||||||||||||||| |
|
|
| T |
11085756 |
tggtggtcggagtttgaatctcgaaccttgcatatattatgcattgt |
11085802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12671739 - 12671785
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||| ||||||||||| |
|
|
| T |
12671739 |
tggtggtcgaggttcgaaccccggatcttgcatattttatgcattgt |
12671785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14197422 - 14197468
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| | ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14197422 |
tggtggttgaggtttgaaccccggatcttacatatattatgcattgt |
14197468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14542751 - 14542797
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| || ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
14542751 |
tggtgttcagggttcgaaccccagaccttgcatatattatgcattgt |
14542797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15988487 - 15988441
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||| |||||||||| |
|
|
| T |
15988487 |
tggtggtcgaggttcgaaccccggaccttgtatatagtatgcattgt |
15988441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 17948127 - 17948173
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||| ||||||||||| |
|
|
| T |
17948127 |
tggtggtcggggtttgaactccgaaccttacatattttatgcattgt |
17948173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23247589 - 23247635
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||||||||||| |||| |
|
|
| T |
23247589 |
tggtggccggggtttaaaccccagaccttgcatatattatgcgttgt |
23247635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23304007 - 23304053
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
23304007 |
tggtggccggggttcgcaccccggaccttgcatatattatgccttgt |
23304053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 23810019 - 23809973
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
23810019 |
tggtggccggggtttgaaccctgaaccttgcatatattatgctttgt |
23809973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 410 - 451
Target Start/End: Complemental strand, 24414655 - 24414613
Alignment:
| Q |
410 |
ttggtggtcggggttt-gaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
24414655 |
ttggtggtcggggttttgaaccccagaccttgcatatattatg |
24414613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 31041707 - 31041753
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||||||||||||| |||||| |
|
|
| T |
31041707 |
tggtggtcggagttcgaaccccggacattgcatatattatacattgt |
31041753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32180900 - 32180854
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||| ||||||||||| |
|
|
| T |
32180900 |
tggtggtcggggttcgaaccccagactttgcatattttatgcattgt |
32180854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32268151 - 32268105
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32268151 |
tggtggtcggagtttgaaccccaaacctttcatatattatgcattgt |
32268105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 32923202 - 32923240
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32923202 |
ggggtttgaaccccgaaccttacatatattatgcattgt |
32923240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 38453327 - 38453289
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
38453327 |
ggggttcgaaccctggaccttgcatatattatgcattgt |
38453289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 42344609 - 42344655
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
42344609 |
tggtggtcgatgtttgaacctcggaccttgcatatattatacattgt |
42344655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 43499661 - 43499615
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||| |||| |||||| |
|
|
| T |
43499661 |
tggtggccggggtttgaaccccggaccttgtatattttatacattgt |
43499615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 48171951 - 48171905
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
48171951 |
tggtggtcggggtttgaacctagaaccttgcatatattatacattgt |
48171905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 50380827 - 50380873
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| | ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
50380827 |
tggtggtcgagatttgaactccggaccttacatatattatgcattgt |
50380873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 56497599 - 56497645
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
56497599 |
tggtggccgggattcgaaccccagaccttgcatatattatgcattgt |
56497645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 454
Target Start/End: Original strand, 2434451 - 2434492
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
2434451 |
gtggtcgaggtttgaacccctgaccttgcatatagtatgcat |
2434492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 2649733 - 2649770
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
2649733 |
gggttcgaactccggaccttgcatatattatgcattgt |
2649770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 451
Target Start/End: Complemental strand, 19314230 - 19314197
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
19314230 |
cggggtttgagccccggaccttgcatatattatg |
19314197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 21449898 - 21449935
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
21449898 |
gggtttgaaccctggaccttgcatatatcatgcattgt |
21449935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 457
Target Start/End: Complemental strand, 31542656 - 31542615
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31542656 |
gtcggggattgaaccccggaccttacatatattatgtattgt |
31542615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 37255009 - 37254972
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37255009 |
gggttcgaaccccggaccttacatatattatgcattgt |
37254972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 455
Target Start/End: Complemental strand, 43155146 - 43155105
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
43155146 |
tggtcggggtttgaacctcagatcttgcatatattatgcatt |
43155105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 49308881 - 49308844
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
49308881 |
gggttcgaaccccagaccttgcatatattatgcattgt |
49308844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 457
Target Start/End: Original strand, 49952663 - 49952708
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
49952663 |
ggtggccgggatttgaaccactgaccttgcatatattatgcattgt |
49952708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 457
Target Start/End: Original strand, 51436602 - 51436643
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
51436602 |
gtcggggttcgaactccgaaccttgcatatattatgcattgt |
51436643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 54859709 - 54859746
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54859709 |
gggtttgaacccaagaccttgcatatattatgcattgt |
54859746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 1757043 - 1756999
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
1757043 |
gtggccggggtttgaactacggaccttgcatattttatgcattgt |
1756999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 409 - 457
Target Start/End: Original strand, 10401385 - 10401433
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| || ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
10401385 |
gttggtggtcaggatttgaaccctggaccttgcatattgtatgcattgt |
10401433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 19854625 - 19854589
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19854625 |
ggttcgaaccccggatcttgcatatattatgcattgt |
19854589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 23225933 - 23225889
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
23225933 |
gtggtcagggtttgaaccccgaatcttgcatatattatgaattgt |
23225889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 23686290 - 23686334
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
23686290 |
tggtggttggggtttgaaccccgaatcttgcatatattatacatt |
23686334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 420 - 455
Target Start/End: Original strand, 29244284 - 29244320
Alignment:
| Q |
420 |
gggtttgaacc-ccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29244284 |
gggtttgaacctccggaccttgcatatattatgcatt |
29244320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 30135210 - 30135166
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
30135210 |
tggtggtcggggtttgaacctcggatctgacatatattatgcatt |
30135166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 30847975 - 30848019
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| || ||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
30847975 |
gtggttggagtttgaacctcggaccttgcatattttatgcattgt |
30848019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 31692623 - 31692667
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
31692623 |
tggtggtcggggtttgaatccaggatgttgcatatattatgcatt |
31692667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 443
Target Start/End: Complemental strand, 33037067 - 33037035
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcat |
443 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
33037067 |
tggtggtcggggtttgaacctcggaccttgcat |
33037035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 35021460 - 35021504
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||| ||||| |
|
|
| T |
35021460 |
gtggtcggggttcgaaccccgaaccttgcatattttatgtattgt |
35021504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 36479063 - 36479015
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||| ||||| || ||||| ||||||||||||||||| |
|
|
| T |
36479063 |
gttggcggtcggggttcgaacctcgaaccttacatatattatgcattgt |
36479015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 37725714 - 37725758
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||| |||||| |
|
|
| T |
37725714 |
gtggtcggggtttaaaccccgaaccttgcatattttatacattgt |
37725758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 37735857 - 37735813
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
37735857 |
gtggtcgaggtttgaacctcagaccttacatatattatgcattgt |
37735813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 39595928 - 39595968
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
39595928 |
tggtggtcggagtttgaacctcagaccttgcatatattatg |
39595968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 39974562 - 39974526
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
39974562 |
ggtttgaaccccagaccttccatatattatgcattgt |
39974526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 53190365 - 53190321
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
53190365 |
tggtgggcgggattcgaaccctggaccttgcatatattatgcatt |
53190321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 116)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 31815878 - 31815924
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31815878 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
31815924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 660812 - 660859
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
660812 |
ttggtggtcggggtttgaaccctggaccttgcatatattatgcattgt |
660859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 20565066 - 20565112
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20565066 |
tggtggttggggtttgaaccccggaccttgcatatattatgcattgt |
20565112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23250311 - 23250357
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23250311 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgt |
23250357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29544697 - 29544651
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29544697 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
29544651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 8781643 - 8781687
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcattgt |
8781687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 27848228 - 27848184
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27848228 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 31543082 - 31543038
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31543082 |
tggtggttggggtttgaaccccggaccttgcatatattatgcatt |
31543038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 42791363 - 42791319
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcattgt |
42791319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 411 - 454
Target Start/End: Original strand, 10735822 - 10735865
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10735822 |
tggtggccggggtttgaaccccggaccttgcatatattatgcat |
10735865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 29734758 - 29734715
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcatatattatgcattgt |
29734715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 4180765 - 4180723
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4180765 |
gtggtcggggtttgaaccccggaccttgcatattttatgcatt |
4180723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 9547400 - 9547446
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9547400 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcattgt |
9547446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20200775 - 20200729
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20200775 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgt |
20200729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23407009 - 23407055
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23407009 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcattgt |
23407055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 24581008 - 24581054
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
24581008 |
tggtggtcggggtttgaacctcgaaccttgcatatattatgcattgt |
24581054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 24592837 - 24592883
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24592837 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
24592883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 25186241 - 25186279
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25186241 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
25186279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 25612284 - 25612330
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25612284 |
tggtggtcgggggttgaatcccggaccttgcatatattatgcattgt |
25612330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 29896285 - 29896331
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29896285 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcattgt |
29896331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 413 - 454
Target Start/End: Original strand, 40853811 - 40853852
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcat |
40853852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 5168570 - 5168614
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5168570 |
tggtagtcggggtttgaaccccgaaccttgcatatattatgcatt |
5168614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 8091151 - 8091195
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcattgt |
8091195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 18693655 - 18693699
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcattgt |
18693699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 22709153 - 22709109
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgt |
22709109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 36264470 - 36264514
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
36264470 |
tggtggtcggggtttgaaccccgaactttgcatatattatgcatt |
36264514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 36359374 - 36359338
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcattgt |
36359338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 43043155 - 43043202
Alignment:
| Q |
411 |
tggtggtcgggg-tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
43043155 |
tggtggtcgggggtttgaaccccggaccttgcatacattatgcattgt |
43043202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 44526199 - 44526152
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
44526199 |
ttggtggccggggtttgaatcccggaccttgcgtatattatgcattgt |
44526152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 346117 - 346159
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
346117 |
gtggtcggggtttgaaccctggaccttacatatattatgcatt |
346159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 2257041 - 2256995
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
2257041 |
tggtggccggggttcgaaccccagaccttgcatatattatgcattgt |
2256995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 3708763 - 3708717
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
3708763 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
3708717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 4138061 - 4138015
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
4138061 |
tggtggtcggggtttgaatctcggaccttgcatatattatacattgt |
4138015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 4557762 - 4557808
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
4557762 |
tggtggtcagggtttgaaccacggaccttacatatattatgcattgt |
4557808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11868653 - 11868699
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
11868653 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
11868699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12599856 - 12599902
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
12599856 |
tggtggtcggggttcgaaccccagaccttgcatatattatgtattgt |
12599902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20455961 - 20455915
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
20455961 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
20455915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 20990895 - 20990941
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
20990895 |
tggtggtcggggtttgaaccctgaaccttgcatattttatgcattgt |
20990941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 24593446 - 24593400
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24593446 |
tggtgttcagggttcgaaccccggaccttgcatatattatgcattgt |
24593400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 25625786 - 25625740
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
25625786 |
tggtggtccgggtttgaaccccggaccttacatatattatgaattgt |
25625740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 453
Target Start/End: Complemental strand, 27411162 - 27411120
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27411162 |
tggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 29600007 - 29599965
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
29600007 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
29599965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 30089119 - 30089073
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgt |
30089073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 30125723 - 30125677
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgt |
30125677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 34977274 - 34977228
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgt |
34977228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35360046 - 35360092
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
35360046 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
35360092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35820292 - 35820338
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35820292 |
tggtggccgaggtttgaaccccggaccttgcatgtattatgcattgt |
35820338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 41859922 - 41859876
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgt |
41859876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 416 - 457
Target Start/End: Complemental strand, 32458367 - 32458326
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32458367 |
gtcggagtttgaaccctggaccttgcatatattatgcattgt |
32458326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 419 - 456
Target Start/End: Complemental strand, 44810767 - 44810730
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44810767 |
ggggtttgaaccccggaccttgcatatattatgtattg |
44810730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 10724009 - 10723965
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
10724009 |
tggtggccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 12124605 - 12124569
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcattgt |
12124569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 21482510 - 21482554
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
21482510 |
tggtggtcggggttcaaaccccggaccttgcatatattatacatt |
21482554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 41356220 - 41356176
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
41356220 |
gtggtcggggtttgaaccccgaaccttgtatattttatgcattgt |
41356176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 3113721 - 3113764
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||||| |
|
|
| T |
3113721 |
tggtcgggatttgaatcccggaccttgcatattttatgcattgt |
3113764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 4927447 - 4927486
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
4927447 |
cggggtttgaaccccggaccttacatatattatgctttgt |
4927486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 7206188 - 7206149
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
7206188 |
cggggtttaaacctcggaccttgcatatattatgcattgt |
7206149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Complemental strand, 8728889 - 8728846
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
8728889 |
tggtggtcggggtttgaaccctggatcttgcatattttatgcat |
8728846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 11560561 - 11560522
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11560561 |
cggggtttgaaccctgaaccttgcatatattatgcattgt |
11560522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 12413556 - 12413517
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
12413556 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
12413517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 12425616 - 12425577
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
12425616 |
cggggtttgaacctcagaccttgcatatattatgcattgt |
12425577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Original strand, 15447705 - 15447748
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
15447705 |
tggtggccggggtttgaactccagaccttgcatatattatgcat |
15447748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Complemental strand, 16390673 - 16390630
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
16390673 |
tggtggccggggttcgaaccccggaccttgcatattttatgcat |
16390630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 18290722 - 18290683
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
18290722 |
tggtggtcggagtttgaaccccgaaccttgcatatattat |
18290683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 19976224 - 19976177
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
19976224 |
tggtggtcgaggttcgaaccccggaccttgcatattattatgcattgt |
19976177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 20120719 - 20120758
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20120719 |
cgggatttgaaccccgaaccttgcatatattatgcattgt |
20120758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 21870886 - 21870933
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
21870886 |
tggtggtcggggttcgaaccccgaaccttgcatattattatgcattgt |
21870933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 24579670 - 24579705
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24579670 |
gtttgaaccctggaccttgcatatattatgcattgt |
24579705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 451
Target Start/End: Original strand, 26387544 - 26387579
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26387544 |
gtcggggtttgaactccggaccttgcatatattatg |
26387579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 27244724 - 27244681
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
27244724 |
tggtcgggctttgaaccctagaccttgcatatattatgcattgt |
27244681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35456811 - 35456858
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatatt-atgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35456811 |
tggtggttggggtttgaaccccgaaccttgcatatattaatgcattgt |
35456858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Complemental strand, 37852080 - 37852037
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
37852080 |
tggtggttagggtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 41748746 - 41748793
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||| ||||||||||| |
|
|
| T |
41748746 |
ttggtggtcggggtttgaatcccggatcttacatattttatgcattgt |
41748793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 41763876 - 41763915
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
41763876 |
cggggtttgaaccccggaccgtgcatatactatgcattgt |
41763915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 41853436 - 41853389
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||| |||| ||||||||| ||||||||||||||||| |
|
|
| T |
41853436 |
ttggtggccggggttcgaacgccggaccttacatatattatgcattgt |
41853389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 44694751 - 44694712
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44694751 |
cggggtttgaaccccgagccttgcatatattatgcattgt |
44694712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 3197071 - 3197116
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
3197071 |
tggtggtcggggtttgaatcc-gaaccttgcatatattatgcattgt |
3197116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 4238829 - 4238783
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
4238829 |
tggtggtcggagttcgaaccccgaaccttacatatattatgcattgt |
4238783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 6765680 - 6765634
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
6765680 |
tggtggtcgtggttcgaaccccggaccttacatattttatgcattgt |
6765634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 7537179 - 7537134
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
7537179 |
tggtggttggggtt-gaactccggaccttgcatatattatgcattgt |
7537134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 11175855 - 11175809
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
11175855 |
tggtggccggagtttgaaccccagatcttgcatatattatgcattgt |
11175809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 13100257 - 13100299
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13100257 |
gtggtcggagtttgaacctcggaccttggatatattatgcatt |
13100299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 13143178 - 13143132
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
13143178 |
tggtggtcagggttcaaacccccgaccttgcatatattatgcattgt |
13143132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 17142900 - 17142854
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||||| |||||| |
|
|
| T |
17142900 |
tggtggtcggggtttgaactccagactttgcatatattatacattgt |
17142854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 415 - 457
Target Start/End: Complemental strand, 19160007 - 19159965
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19160007 |
ggtcggagtttgaactccgaaccttgcatatattatgcattgt |
19159965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 19967488 - 19967442
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
19967488 |
tggtggtcgaggtttgaactccgaaccttgcacatattatgcattgt |
19967442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 22571868 - 22571902
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
22571868 |
tttgaaccccggacattgcatatattatgcattgt |
22571902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 25274820 - 25274866
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
25274820 |
tggtgttcggggttcgaaccccagaccttacatatattatgcattgt |
25274866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 25395433 - 25395479
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
25395433 |
tggtggtcgggatttgaaccttgaaccttgcatatattatgcattgt |
25395479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 26999180 - 26999134
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26999180 |
tggtggccggagtttgaaccgcagaccttgcatatattatgcattgt |
26999134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 27412827 - 27412873
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
27412827 |
tggtggtcggggtttgaacaacagaccttacatatattatgcattgt |
27412873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 30243320 - 30243274
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
30243320 |
tggtggccgaggtttgaaccccgaaccttgtatatattatgcattgt |
30243274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 421 - 455
Target Start/End: Complemental strand, 30978422 - 30978388
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
30978422 |
ggtttgaacccctgaccttgcatatattatgcatt |
30978388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 33064056 - 33064010
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
33064056 |
tggtggccggagttcgaactccggaccttgcatatattatgcattgt |
33064010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 34469863 - 34469909
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
34469863 |
tggtggtcggggttcgaaccccggaccttgcataagctatgcattgt |
34469909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 36441158 - 36441204
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
36441158 |
tggtggtcagggttttaaccccggacaatgcatatattatgcattgt |
36441204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Complemental strand, 36474820 - 36474786
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36474820 |
tttgaaccccggaccttgcatattttatgcattgt |
36474786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 38904131 - 38904085
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
38904131 |
tggtggttagggtttgaaccctgaaccttgcatatattatgcattgt |
38904085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 40994768 - 40994814
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
40994768 |
tggtggtcggtgtttgaaccccgaaccttgcatctattatgtattgt |
40994814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 41778935 - 41778981
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
41778935 |
tggtggccgggattcgaacctcggaccttgcatatattatgcattgt |
41778981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 43117189 - 43117227
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcattgt |
43117227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 3904263 - 3904226
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgt |
3904226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 452
Target Start/End: Complemental strand, 10811130 - 10811097
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgc |
452 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
10811130 |
ggggtttgaaccccggaccttgcatattttatgc |
10811097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 457
Target Start/End: Complemental strand, 12751322 - 12751281
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
12751322 |
gtcggggtttgaaccccgaaccttgcatattctatgcattgt |
12751281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 17328006 - 17328043
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
17328006 |
gggtttgaaccccggaccttgcttattttatgcattgt |
17328043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 25598562 - 25598599
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
25598562 |
gggttcgaaccctggaccttgcatatattatgcattgt |
25598599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 455
Target Start/End: Original strand, 35281205 - 35281246
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
35281205 |
tggtcggggtttgaacctcgaaccttgcatatattatacatt |
35281246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 43356542 - 43356579
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
43356542 |
gggttcgaacctcggaccttgcatatattatgcattgt |
43356579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 7052837 - 7052797
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
7052837 |
cggggtttgagccccggaccttgcatattattatgcattgt |
7052797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 12124744 - 12124708
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
12124744 |
ggttcgaactccggaccttgcatatattatgcattgt |
12124708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 18611964 - 18612000
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18611964 |
ggtttgaaccccaaaccttgcatatattatgcattgt |
18612000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 21929538 - 21929494
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
21929538 |
gtggccggggtttgaacccctgaccttgtatattttatgcattgt |
21929494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 26427868 - 26427828
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
26427868 |
tggtggtcgggatttgagacccggaccttgcatatattatg |
26427828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 31477041 - 31476997
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
31477041 |
tggtggccgggatttgaaccccgaaccttgtatatattatgcatt |
31476997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 33890169 - 33890213
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||| ||||||||| |||||||||||| |||| |
|
|
| T |
33890169 |
gtggtcggagtttgaacgccggaccttacatatattatgcgttgt |
33890213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 42347736 - 42347692
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
42347736 |
gtggtcggagtttgaacactggaccttgcatattttatgcattgt |
42347692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 5e-17; HSPs: 116)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 19599214 - 19599169
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19599169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 27462427 - 27462473
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27462427 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
27462473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 27833392 - 27833438
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27833392 |
tggtggtcggggtttgaaccccggaccttacatatattatgcattgt |
27833438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 48629056 - 48629102
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgt |
48629102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 7670502 - 7670458
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7670502 |
gtggtcgaggtttgaaccccggaccttgcatatattatgcattgt |
7670458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 18714511 - 18714472
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18714511 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
18714472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 449
Target Start/End: Complemental strand, 145588 - 145550
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
449 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
145588 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 3671894 - 3671848
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
3671894 |
tggtggtcggggtttgaactccagaccttgcatatattatgcattgt |
3671848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 453
Target Start/End: Complemental strand, 5579763 - 5579721
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5579763 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
5579721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 18023749 - 18023703
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18023749 |
tggtggtcggagtttgaaccctggaccttgcatatattatgcattgt |
18023703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 18773747 - 18773793
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
18773747 |
tggtggtcggggtttgaaccccggaccttacatattttatgcattgt |
18773793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 19416584 - 19416538
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19416584 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
19416538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 20085758 - 20085796
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
20085796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 45088945 - 45088900
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45088945 |
tggtggtcggggtttgaaccccg-accttgcatatattatgcattgt |
45088900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 10244788 - 10244751
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgt |
10244751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 10242550 - 10242506
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10242550 |
tggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 19626518 - 19626562
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgt |
19626562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 26529682 - 26529726
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 46371051 - 46371007
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
46371051 |
tggtggtcggagtttgaaccccggaccttggatatattatgcatt |
46371007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 46737853 - 46737809
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgt |
46737809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 47342427 - 47342471
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47342427 |
gtggtcggagtttgaactccggaccttgcatatattatgcattgt |
47342471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 23198743 - 23198786
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcatattttatgcattgt |
23198786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 29726867 - 29726824
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcatatattatacattgt |
29726824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 39280820 - 39280855
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcattgt |
39280855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 46987149 - 46987110
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46987149 |
cggggttcgaaccccggaccttgcatatattatgcattgt |
46987110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 3584274 - 3584228
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
3584274 |
tggtggtcggggtttgaatctcgtaccttgcatatattatgcattgt |
3584228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 3830130 - 3830092
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3830130 |
ggggtttgaaccctggaccttgcatatattatgcattgt |
3830092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 6023379 - 6023333
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
6023379 |
tggtggtcggggtttgaaccccgaaccttgcatattttaagcattgt |
6023333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 7388030 - 7388076
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
7388030 |
tggtggtcggggtttgaatcccgaaccttacatatattatgcattgt |
7388076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8084497 - 8084451
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
8084497 |
tggtggccggggttcgaaccccggaccttgcatattttatgcattgt |
8084451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 10026064 - 10026018
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10026064 |
tggtggtcggggtttgaaccccataccttgcatattttatgcattgt |
10026018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 12167477 - 12167431
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12167477 |
tggtggttggggtttgaatcccggaccttgaatatattatgcattgt |
12167431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20763224 - 20763178
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
20763224 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
20763178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 28230849 - 28230803
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28230849 |
tggtggtcggtgtttgaaccccggaccttgcatacatcatgcattgt |
28230803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28736624 - 28736670
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
28736624 |
tggtggttggggtttgaacctcggaccttgcatatatcatgcattgt |
28736670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29488790 - 29488744
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
29488790 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
29488744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 33232388 - 33232434
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
33232388 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
33232434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 34284530 - 34284576
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
34284530 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
34284576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 409 - 455
Target Start/End: Original strand, 37495907 - 37495953
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37495907 |
gttggtggtcgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 41029342 - 41029296
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacattgt |
41029296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 42829225 - 42829271
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42829225 |
tggtggccggagtttgaaccccggagcttgcatatattatgcattgt |
42829271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 413 - 454
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36121720 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 421 - 454
Target Start/End: Original strand, 42095944 - 42095977
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42095944 |
ggtttgaaccccggaccttgcatatattatgcat |
42095977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 413 - 454
Target Start/End: Complemental strand, 43139333 - 43139292
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
43139333 |
gtggtcggggtttgaaccccgtaccttgcatattttatgcat |
43139292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 43539104 - 43539141
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgt |
43539141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 7994875 - 7994915
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
7994875 |
tggtggtcggggtttgaaccccagaccttacatatattatg |
7994915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Original strand, 8237621 - 8237669
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
8237621 |
gttggtggccggggtttgaacctcggactttgtatatattatgcattgt |
8237669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 14046602 - 14046646
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14046602 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 14356632 - 14356676
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14356632 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 18684199 - 18684156
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
18684199 |
tggtggtcggggtttgaaccc-ggaccttgcatacattatgcatt |
18684156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 21105673 - 21105629
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
21105673 |
tggtggtcggggttcgaacctcgaaccttgcatatattatgcatt |
21105629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 21322245 - 21322201
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21322245 |
tggtggccggggtttgaaccctggaccttgcatacattatgcatt |
21322201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 21554925 - 21554969
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
21554925 |
tggtggtcggggtttgaatcctggaccttgcatatattaagcatt |
21554969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 418 - 450
Target Start/End: Complemental strand, 23147353 - 23147321
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23147353 |
cggggtttgaaccccggaccttgcatatattat |
23147321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 25602985 - 25602941
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
25602985 |
gtggttggggtttcaaccccgggccttgcatatattatgcattgt |
25602941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 26717919 - 26717963
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26717919 |
tggtggtcagagtttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 34448603 - 34448647
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcattgt |
34448647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 45046206 - 45046246
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
45046206 |
tggtggtcagagtttgaaccccggaccttgcatatattatg |
45046246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Complemental strand, 2618734 - 2618703
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2618734 |
gaaccccggaccttgcatatattatgcattgt |
2618703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 5041398 - 5041363
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatattatgcattgt |
5041363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 6781870 - 6781831
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
6781870 |
cggggtttgaaccctggaccttgcatattttatgcattgt |
6781831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 7735601 - 7735554
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
7735601 |
ttggtggtcgggctttgaaccctagaccttgcatattttatgcattgt |
7735554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8290460 - 8290507
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| ||||||||||||| |
|
|
| T |
8290460 |
tggtggtcgggattcgaaccccggaccttgcatattattatgcattgt |
8290507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Original strand, 37516796 - 37516839
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
37516796 |
tggtcgaggtttgaactccggaccttgcatatgttatgcattgt |
37516839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 38374189 - 38374228
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
38374189 |
cggggtttgaaccctggaccttgcatatactatgcattgt |
38374228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 40867089 - 40867054
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40867089 |
gtttgaaccccggaccttgcatatactatgcattgt |
40867054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 42336141 - 42336094
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| | || |||||||||||||||||| ||||||||||||| |
|
|
| T |
42336141 |
ttggtggtcgagattcgaaccccggaccttgcatgtattatgcattgt |
42336094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 453
Target Start/End: Original strand, 42753529 - 42753560
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42753529 |
gtttgaaccccggaccttgcatatattatgca |
42753560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 47155102 - 47155141
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
47155102 |
cggggttcgaaccctggaccttgcatatattatgcattgt |
47155141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 580917 - 580963
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||||||| ||||||||||| |
|
|
| T |
580917 |
tggtggtcggggttcgaacgccggatcttgcatattttatgcattgt |
580963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 1079695 - 1079729
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1079695 |
tttgaaccccggaccttgcatattttatgcattgt |
1079729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 4905346 - 4905300
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
4905346 |
tggtggccggggtttgaactccgaaccttgcatattttatgcattgt |
4905300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 5458062 - 5458108
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5458062 |
tggtgttcgaggtttgaatcccagaccttgcatatattatgcattgt |
5458108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 9522982 - 9522936
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcattgt |
9522936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 14671240 - 14671194
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
14671240 |
tggtgatcgggattcgaaccccggaccttgtatatattatgcattgt |
14671194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15135154 - 15135108
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| |||| || |||||||||||||| |||||| |
|
|
| T |
15135154 |
tggtggtcggggtttgatccccagagcttgcatatattatacattgt |
15135108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16577851 - 16577897
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16577851 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgt |
16577897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 16587811 - 16587765
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
16587811 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgt |
16587765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19036093 - 19036139
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
19036093 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgt |
19036139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20718543 - 20718497
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
20718543 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgt |
20718497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 29053111 - 29053069
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29053111 |
gtggtcggagtttgaaccccggaccttggatatattaagcatt |
29053069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 409 - 451
Target Start/End: Complemental strand, 29986669 - 29986627
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29986669 |
gttggtggacggggtttgaaccctggaccttgcgtatattatg |
29986627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 31038513 - 31038559
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
31038513 |
tggtggccggggtttgaaccccagaccttgcatacaatatgcattgt |
31038559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 33473512 - 33473558
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
33473512 |
tggtggccagggttggaaccctggaccttgcatatattatgcattgt |
33473558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 33610916 - 33610962
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
33610916 |
tggtggccggtgttcgaactccggaccttgcatatattatgcattgt |
33610962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 35222986 - 35222948
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35222986 |
ggggtttgaaccccagaccttgcatatatcatgcattgt |
35222948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 36341056 - 36341102
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
36341056 |
tggtggtcgaggtttgaactccggaccttgtatattttatgcattgt |
36341102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 37624613 - 37624567
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || ||||||| |||||||||||||||||||||||| |
|
|
| T |
37624613 |
tggtggccgggattcgaacccccgaccttgcatatattatgcattgt |
37624567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 37930114 - 37930068
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| |||| | | ||||||||||||||||||| |
|
|
| T |
37930114 |
tggtggtcggggtttgaatcccgaatcctgcatatattatgcattgt |
37930068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 39801776 - 39801730
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
39801776 |
tggtggttggggttcgtaccccggatcttgcatatattatgcattgt |
39801730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 40187627 - 40187673
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
40187627 |
tggtgttcggggtttgaaccgcagaccttacatatattatgcattgt |
40187673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 40752830 - 40752876
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatgtattgt |
40752876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 415 - 457
Target Start/End: Complemental strand, 40875108 - 40875066
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
40875108 |
ggtcgaggttcgaaccccggacattgcatatattatgcattgt |
40875066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 41250038 - 41250084
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
41250038 |
tggtgttcggggcttgaacctcggaccttgcatatattatacattgt |
41250084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 42227796 - 42227842
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
42227796 |
tggtggtcggagtttgaacctcgaaccttacatatattatgcattgt |
42227842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 45425523 - 45425477
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
45425523 |
tggtggccgggattcgaaccccgaaccttgcatatattatgcattgt |
45425477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 48527260 - 48527214
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
48527260 |
tggtggccgggattcgaactccggaccttgcatatattatgcattgt |
48527214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 452
Target Start/End: Complemental strand, 2512379 - 2512338
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgc |
452 |
Q |
| |
|
|||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
2512379 |
tggtggccggggtttgaacctcgtaccttgcatatattatgc |
2512338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 2916062 - 2916025
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
2916062 |
gggtttgaaccccggaccttgtatatattatacattgt |
2916025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 455
Target Start/End: Original strand, 6225720 - 6225761
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
6225720 |
tggtcggggtttgaaccacagaccttgcatttattatgcatt |
6225761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 6384912 - 6384875
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
6384912 |
gggttcgaaccccagaccttgcatatattatgcattgt |
6384875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 7872748 - 7872785
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
7872748 |
gggttcgaaccccagaccttgcatatattatgcattgt |
7872785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 453
Target Start/End: Original strand, 40808159 - 40808192
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
40808159 |
gggtttgaaccccggaccttgcatattttatgca |
40808192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 457
Target Start/End: Original strand, 44868147 - 44868192
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
44868147 |
ggtggtcggaatttgaacctcggaccttacatatattatgcattgt |
44868192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 426 - 454
Target Start/End: Original strand, 394366 - 394394
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
394366 |
gaaccccggaccttgcatatattatgcat |
394394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 3536247 - 3536291
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
3536247 |
gtggtcggagtttgaatcccgaaccttacatatattatgcattgt |
3536291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 19578138 - 19578174
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19578138 |
ggtttgaaccccagaccttgcatattttatgcattgt |
19578174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 29237558 - 29237594
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
29237558 |
ggttcgaaccctggaccttgcatatattatgcattgt |
29237594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 30006083 - 30006127
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
30006083 |
tggtggttggggtttgaaccccaaaccttgcatacattatgcatt |
30006127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 30623040 - 30622996
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
30623040 |
gtggtcggggtttgaaccatagaccttgcatatattatgtattgt |
30622996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 31281766 - 31281802
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
31281766 |
ggtttgaatcccagaccttgcatatattatgcattgt |
31281802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 423 - 455
Target Start/End: Original strand, 37230031 - 37230063
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37230031 |
tttgaaccccagaccttgcatatattatgcatt |
37230063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 39926539 - 39926575
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39926539 |
ggtttgaaccccgaacattgcatatattatgcattgt |
39926575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 418 - 450
Target Start/End: Original strand, 46418526 - 46418558
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
46418526 |
cggggtttgaaccccggactttgcatatattat |
46418558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 46552063 - 46552019
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| || |||||| ||||||| ||||||||| |
|
|
| T |
46552063 |
gtggtcggggtttgaactcctgacctttcatatatcatgcattgt |
46552019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 47607901 - 47607941
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
47607901 |
tggtggccggagtttgaaccctggaccttgcatatattatg |
47607941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 98)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 409 - 457
Target Start/End: Original strand, 32200436 - 32200484
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32200436 |
gttggtggtcggggcttgaaccccggaccttgcatatattatgcattgt |
32200484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 13864414 - 13864368
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13864414 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
13864368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 22522792 - 22522838
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22522792 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
22522838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 40715940 - 40715986
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40715940 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
40715986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 6489077 - 6489031
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6489077 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgt |
6489031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 6624846 - 6624800
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6624846 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
6624800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15889481 - 15889435
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15889481 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcattgt |
15889435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16579365 - 16579411
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16579365 |
tggtggtcagggtttgaaccacggaccttgcatatattatgcattgt |
16579411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16701572 - 16701618
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
16701572 |
tggtggtcggggtttgaatcccggaccttgcatatattattcattgt |
16701618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20721120 - 20721074
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20721120 |
tggtagtcggggtttgaaccccggaccttgcatatattatgtattgt |
20721074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 27903183 - 27903137
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcattgt |
27903137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 34436921 - 34436875
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34436921 |
tggtgggcggggtttgaaccccggcccttgcatatattatgcattgt |
34436875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 42817103 - 42817149
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42817103 |
tggtggtcgaggtttgaaccccggaccttgtatatattatgcattgt |
42817149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 413 - 454
Target Start/End: Complemental strand, 24408563 - 24408522
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24408563 |
gtggtcggggtttgaaccccagaccttgcatatattatgcat |
24408522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 5107236 - 5107280
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcatt |
5107280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 34191501 - 34191457
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgt |
34191457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 39980578 - 39980534
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
39980578 |
tggtggtcggggtttgaactccggaccttgcatattttatgcatt |
39980534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 42473954 - 42473918
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcattgt |
42473918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 13409617 - 13409574
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
13409617 |
tggtcggggtttgaactccggaccttgtatatattatgcattgt |
13409574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 25979915 - 25979868
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25979915 |
ttggtggccgaggtttgaaccccggaccttgcatacattatgcattgt |
25979868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 26409324 - 26409277
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26409324 |
ttggtgggcggggttcgaaccccggaccttacatatattatgcattgt |
26409277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 39914971 - 39914925
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
39914971 |
ttggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgt |
39914925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 1538799 - 1538845
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
1538799 |
tggtggtcggcgtttgaacctcggaccttgcatatattatgcgttgt |
1538845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 3445238 - 3445284
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
3445238 |
tggtggccgggatttgaaccccggaccttgcatacattatgcattgt |
3445284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 6424902 - 6424940
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6424902 |
ggggtttgaaccccggaccttgtatatattatgcattgt |
6424940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8544980 - 8545026
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8544980 |
tggtggtcggagttcgaactccggaccttgcatatattatgcattgt |
8545026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 10531610 - 10531564
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
10531610 |
tggtagtcggggtttgaaccacggaccgtgcatatattatgcattgt |
10531564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11637563 - 11637609
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgt |
11637609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 11720963 - 11720918
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11720963 |
tggtggccggggtttgaaccccg-accttgcatatattatgcattgt |
11720918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 13796400 - 13796354
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
13796400 |
tggtggtcggagtttgtaccccagaccttgcatatattatgcattgt |
13796354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 14474904 - 14474858
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
14474904 |
tggtggccggggtttgaaccctggaccttgcatatattatgcgttgt |
14474858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 18331777 - 18331731
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
18331777 |
tggtggccggggcttgaaccccggaccttgcatattttatgcattgt |
18331731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19518591 - 19518637
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
19518591 |
tggtggtcgaggtttgaacccccggccttgcatatattatgcattgt |
19518637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 26655534 - 26655488
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26655534 |
tggtggccggggttcgaaccccggaccttacatatattatgcattgt |
26655488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 26927119 - 26927073
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
26927119 |
tggtggccggggttcgaaccccggaccttacatatattatgcattgt |
26927073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29695085 - 29695039
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
29695085 |
tggtggtcggggtttgaaccacgaaccttacatatattatgcattgt |
29695039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 31280089 - 31280043
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31280089 |
tggtggtcgaggtttgaaccccggatattgcatatattatgcattgt |
31280043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32234831 - 32234786
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
32234831 |
tggtggtcggggtttgaacccc-gaccttgcatattttatgcattgt |
32234786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32339805 - 32339759
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
32339805 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35493964 - 35494010
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
35493964 |
tggtggtcggagtttgaatcccgaaccttgcatatattatgcattgt |
35494010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 37462181 - 37462135
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
37462181 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
37462135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 37932400 - 37932354
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37932400 |
tggtggccagggttcgaaccccggaccttgcatatattatgcattgt |
37932354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 18589867 - 18589904
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18589867 |
gggtttaaaccccggaccttgcatatattatgcattgt |
18589904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 418 - 455
Target Start/End: Original strand, 21139146 - 21139183
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21139146 |
cgggttttgaaccccggaccttgcatatattatgcatt |
21139183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 413 - 450
Target Start/End: Original strand, 40837896 - 40837933
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcatattttat |
40837933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 4763187 - 4763223
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4763187 |
ggtttgaaccccggaccttacatatattatgcattgt |
4763223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 5015352 - 5015304
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
5015352 |
gttggtggttggggtttgaactccgaaccttgcatatattattcattgt |
5015304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 12670065 - 12670109
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12670065 |
tggtggtcaaggtttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 17090936 - 17090892
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17090936 |
tggtggccggggtttgaaccccggaccttgcattaattatgcatt |
17090892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 37021363 - 37021407
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
37021363 |
tggtggtcggggtttgaaccctgaatcttgcatatattatgcatt |
37021407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 4009937 - 4009890
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatatt-atgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
4009937 |
tggtggccggggtttgaaccccggcccttgcatatattaatgcattgt |
4009890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 5846092 - 5846053
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
5846092 |
cggggtttgaaccccagactttgcatatattatgcattgt |
5846053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 10704333 - 10704368
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10704333 |
gtttgaaccccggaccttgcatattttatgcattgt |
10704368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 16076498 - 16076455
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
16076498 |
tggtcggggattgaaccctgaaccttgcatatattatgcattgt |
16076455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 455
Target Start/End: Complemental strand, 16094126 - 16094083
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcatt |
16094083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 20688099 - 20688064
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20688099 |
gtttgaactccggaccttgcatatattatgcattgt |
20688064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 33928698 - 33928663
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33928698 |
gtttaaaccccggaccttgcatatattatgcattgt |
33928663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 416 - 455
Target Start/End: Complemental strand, 38495207 - 38495168
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
38495207 |
gtcggggtttgaaccccgaaccttgcatattttatgcatt |
38495168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 41630110 - 41630149
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
41630110 |
cggggtttgaatcccgaaccttgcatatattatgcattgt |
41630149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 2839866 - 2839824
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
2839866 |
gtggtcggagtttgaaccccgaaccttggatatattatgcatt |
2839824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 3052349 - 3052303
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||| || |||||||||||||||| |||||| |
|
|
| T |
3052349 |
tggtggtcgaggtttgaacctcgaaccttgcatatattatacattgt |
3052303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12611026 - 12611072
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
12611026 |
tggtggtcgaggttcgaaccccagaccttgcatattttatgcattgt |
12611072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 17151833 - 17151879
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
17151833 |
tggtggtcggggtttgaatccaagaccttgcatatattatacattgt |
17151879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 18391670 - 18391624
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
18391670 |
tggtggtcgaggttcgaacctcggaccttgcatattttatgcattgt |
18391624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 18789098 - 18789060
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
18789098 |
ggggtttgaaccccgaaccttgcatattttatgcattgt |
18789060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19647499 - 19647545
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||| |||||| |||||||||| |||||| |
|
|
| T |
19647499 |
tggtggtcgggatttgaaccccagaccttacatatattatacattgt |
19647545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 19759999 - 19759953
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||| | |||| |||||||||||||||||||||||||| |
|
|
| T |
19759999 |
tggtggttggggtcttaacctcggaccttgcatatattatgcattgt |
19759953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 20125095 - 20125050
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20125095 |
tggtggtcggagtttgaaccc-gaaccttgcatatattatgcattgt |
20125050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 22555301 - 22555255
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
22555301 |
tggtggtcggggtttgattcccggaccttgcatattatatgcattgt |
22555255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 26030442 - 26030488
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
26030442 |
tggtggccggggttcgaaccccggaccttgcaagtattatgcattgt |
26030488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 27086140 - 27086102
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
27086140 |
ggggtttgaaccctggaccttgcatatattatacattgt |
27086102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 31877990 - 31877952
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
31877990 |
ggggtttgaacccctgatcttgcatatattatgcattgt |
31877952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 35413026 - 35412981
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
35413026 |
tggtggccggggttcgaaccc-ggaccttgcatatattatgcattgt |
35412981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 37054260 - 37054306
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
37054260 |
tggtggtcggagtttgaaccccgaaccttatatatattatgcattgt |
37054306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 39963563 - 39963517
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| | |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39963563 |
tggtggtcagagtttgaaccccgaaccttacatatattatgcattgt |
39963517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 40959072 - 40959026
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||||| | | ||||||||||||||||||||| |
|
|
| T |
40959072 |
tggtggtcggggtctgaaccctgaatcttgcatatattatgcattgt |
40959026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 41650931 - 41650976
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
41650931 |
tggtggtcggtgtttgaactc-ggaccttgcatatattatgcattgt |
41650976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 453
Target Start/End: Original strand, 8882399 - 8882432
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
8882399 |
gggtttgaaccccggaccttacatatattatgca |
8882432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 454
Target Start/End: Original strand, 17465388 - 17465429
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
17465388 |
gtggtcgaggttcgaaccccagaccttgcatatattatgcat |
17465429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 456
Target Start/End: Original strand, 26418933 - 26418978
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||| |||| |
|
|
| T |
26418933 |
tggtggtcgagatttgaaccccagaccttgcatatattatgtattg |
26418978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 455
Target Start/End: Complemental strand, 27679561 - 27679524
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27679561 |
cgggatttgaaccccgaaccttgcatatattatgcatt |
27679524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 457
Target Start/End: Original strand, 31602821 - 31602862
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
31602821 |
gtcggggtttgaatctcgaaccttgcatatattatgcattgt |
31602862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 454
Target Start/End: Complemental strand, 33412159 - 33412118
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
33412159 |
gtggccggggtttgaatcctggaccttgcatatattatgcat |
33412118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 42515876 - 42515831
Alignment:
| Q |
413 |
gtggtcggggtttgaa-ccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
42515876 |
gtggccggggtttgaatccccggaccttacatatattatgcattgt |
42515831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 5485246 - 5485210
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
5485246 |
ggttagaaccccggacattgcatatattatgcattgt |
5485210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 455
Target Start/End: Complemental strand, 5614827 - 5614791
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
5614827 |
ggggtttgaacccccgaccttacatatattatgcatt |
5614791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 455
Target Start/End: Original strand, 9893670 - 9893706
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
9893670 |
ggggtttgaaccccagaccttgcatattttatgcatt |
9893706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 10706023 - 10705983
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
10706023 |
tcggggtttgaaccccagaccttgcatattttatgtattgt |
10705983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 12218278 - 12218322
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||| || |||||||||||| ||||||||||| |
|
|
| T |
12218278 |
gtggtcgggatttgaactccagaccttgcatattttatgcattgt |
12218322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 19068431 - 19068474
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19068431 |
tggtgatcggggtttgaacccca-accttgcatatattatgcatt |
19068474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 409 - 453
Target Start/End: Original strand, 25603989 - 25604033
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||| |||| || |||||||| ||||||||||||||||||| |
|
|
| T |
25603989 |
gttggtggccgggattcgaaccccgaaccttgcatatattatgca |
25604033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 26166807 - 26166763
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
26166807 |
gtggtcagggtttgaaccctggaccttgcatatttgatgcattgt |
26166763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 31708147 - 31708183
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
31708147 |
ggttcgaaccccagaccttgcatatattatgcattgt |
31708183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 33014245 - 33014281
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
33014245 |
ggtttgaaccccagacctttcatatattatgcattgt |
33014281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 35270682 - 35270718
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
35270682 |
ggtttgaaccctggaccttgcatattttatgcattgt |
35270718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 454
Target Start/End: Original strand, 37073762 - 37073802
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
37073762 |
tggtcggggttcgaaccccgaaccttacatatattatgcat |
37073802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 40541156 - 40541120
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
40541156 |
ggttggaaccccggactttgcatatattatgcattgt |
40541120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 41266456 - 41266416
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
41266456 |
tggtggtcggggtgtgaaccccgaaccttacatatattatg |
41266416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 144)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 12268977 - 12269021
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
12269021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8269359 - 8269405
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8269359 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
8269405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 17139508 - 17139554
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17139508 |
tggtggtcggggtttgaaccccggaccttgaatatattatgcattgt |
17139554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 27533313 - 27533267
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27533313 |
tggtggtcggggtttgaaccccgaaccttgcatatattatgcattgt |
27533267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 2994826 - 2994782
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattatacattgt |
2994782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 18166670 - 18166626
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18166670 |
gtggtcggggtttgaaccccggactttgcatatattatgcattgt |
18166626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 412 - 455
Target Start/End: Complemental strand, 12212364 - 12212321
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcatt |
12212321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 25533036 - 25532997
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25533036 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
25532997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 1794666 - 1794620
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1794666 |
tggtggtcgaggtttgaaccccggatcttgcatatattatgcattgt |
1794620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8736505 - 8736459
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8736505 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
8736459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 16307719 - 16307673
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16307719 |
tggtggtcggggtttgatccccagaccttgcatatattatgcattgt |
16307673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 32950752 - 32950798
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32950752 |
tggtggtcgaggtttgaactccggaccttgcatatattatgcattgt |
32950798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32962633 - 32962587
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32962633 |
tggtggtcggggtttgaaccctggaccttgcatattttatgcattgt |
32962587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 34521181 - 34521227
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34521181 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgt |
34521227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 41973325 - 41973279
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41973325 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
41973279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 13401666 - 13401621
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
13401621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 3481631 - 3481587
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3481631 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatt |
3481587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 22335430 - 22335382
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
22335430 |
gttggtgttcggggtttgaacctcagaccttgcatatattatgcattgt |
22335382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 23203390 - 23203346
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23203390 |
gtggtcggggtttgaaccccgaaccttgcatattttatgcattgt |
23203346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 32561041 - 32560997
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacattgt |
32560997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 34595942 - 34595898
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34595942 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 49431984 - 49432028
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49431984 |
tggtggccggggtttgaaccccggaccttacatatattatgcatt |
49432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 2596930 - 2596977
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2596930 |
ttggaggtcggagtttgaaccccggaccttgcatattttatgcattgt |
2596977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 5907862 - 5907823
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5907862 |
cggggtttgaaccctggaccttgcatatattatgcattgt |
5907823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 6000141 - 6000180
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6000141 |
cggggtttgaacctcggaccttgcatatattatgcattgt |
6000180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 11681286 - 11681247
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11681286 |
cggggtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 453
Target Start/End: Complemental strand, 5280701 - 5280659
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
5280701 |
tggtggtcggggttcgaaccccagaccttgcatatattatgca |
5280659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 15668560 - 15668522
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15668560 |
ggggtttgaaccccggaccttgcatattttatgcattgt |
15668522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16033441 - 16033487
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16033441 |
tggtggccggagtttgaaccccagaccttgcatatattatgcattgt |
16033487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 449
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
449 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23405349 - 23405395
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
23405349 |
tggtggtcgggattcgaaccctggaccttgcatatattatgcattgt |
23405395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 24571616 - 24571662
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
24571616 |
tggtggtcggagtttgaaccccagaccttgcatatattatgtattgt |
24571662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 26803450 - 26803488
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcattgt |
26803488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28832162 - 28832208
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
28832162 |
tggtggtcgggatttgaacctcagaccttgcatatattatgcattgt |
28832208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32944806 - 32944760
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
32944806 |
tggtggtcggggttcgaaccccagacgttgcatatattatgcattgt |
32944760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 33153871 - 33153917
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
33153871 |
tggtgttcggggtttgaacctcggaccttacatatattatgcattgt |
33153917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 39252137 - 39252183
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39252137 |
tggtggttggagtttgaaccccggaccttgcatatattatgtattgt |
39252183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 40613093 - 40613047
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
40613093 |
tggtggtcgagattcgaaccccggaccttgcatatattatgcattgt |
40613047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 41763148 - 41763190
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcatt |
41763190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 41769808 - 41769850
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
41769808 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
41769850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 42045363 - 42045409
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
42045363 |
tggtggccggggtttgaactccagaccttgcatatattatgcattgt |
42045409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 10654447 - 10654484
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10654447 |
gggtttgaaccacggaccttgcatatattatgcattgt |
10654484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 414 - 455
Target Start/End: Complemental strand, 37050996 - 37050955
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
37050996 |
tggtcggggttcgaaccccggaccttgcatattttatgcatt |
37050955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 1605456 - 1605420
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcatattttatgcattgt |
1605420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 3431400 - 3431356
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||| |
|
|
| T |
3431400 |
tggtggtcggggtttgaacctcgtacattgcatatattatgcatt |
3431356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 419 - 451
Target Start/End: Original strand, 3937521 - 3937553
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3937521 |
ggggtttgaaccccggaccttgcatatattatg |
3937553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 425 - 457
Target Start/End: Original strand, 4968620 - 4968652
Alignment:
| Q |
425 |
tgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4968620 |
tgaaccccggaccttgcatatattatgcattgt |
4968652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 5869834 - 5869790
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
5869834 |
tggtggtcggggtttgaactccgaatcttgcatatattatgcatt |
5869790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 447
Target Start/End: Original strand, 6423752 - 6423788
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatat |
447 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6423752 |
tggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 10356706 - 10356749
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10356706 |
tggtggtcggg-tttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 13778631 - 13778587
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
13778631 |
tggtggtcgaggtttgaaccccgaaccttgcatattttatgcatt |
13778587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 26755676 - 26755640
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatataatgcattgt |
26755640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 29042607 - 29042563
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29042607 |
tggtggtcgggatttgaaccccggatcttacatatattatgcatt |
29042563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 29739397 - 29739361
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29739397 |
ggtttgaaccccggaccttgcatattttatgcattgt |
29739361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 46392303 - 46392259
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46392303 |
tggtggtcggaatttgaaccccggaccttggatatattatgcatt |
46392259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 2209284 - 2209237
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatat-tatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
2209284 |
tggtggtcggggtttgaagcccggacctagcatatatatatgcattgt |
2209237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Complemental strand, 8094111 - 8094068
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
8094111 |
tggtggccggggtttaaaccccgcaccttgcatatattatgcat |
8094068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 11462912 - 11462959
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
11462912 |
ttggtggatggggttcgaaccccggaccttgcatattttatgcattgt |
11462959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 12214063 - 12214017
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| ||||| |
|
|
| T |
12214063 |
ttggtggtcggggtt-gaaccccagaccttgcatatattatgtattgt |
12214017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 21638176 - 21638137
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
21638176 |
cggggttcgaaccccggaccttgcatatatcatgcattgt |
21638137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 28006809 - 28006766
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||| |||||| |||||||||||||||||||| |
|
|
| T |
28006809 |
tggtcggggtttaaactccggactttgcatatattatgcattgt |
28006766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 29506894 - 29506851
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||| ||||| |
|
|
| T |
29506894 |
tggtcggggttcgaaccctggaccttgcatatattatgtattgt |
29506851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 36679649 - 36679614
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36679649 |
gtttgaaccccggaccttgcatatattatccattgt |
36679614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Original strand, 38448872 - 38448903
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38448872 |
gaaccccggaccttgcatatattatgcattgt |
38448903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 45003459 - 45003424
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45003459 |
gtttgaaccccggaccttgcatatattatccattgt |
45003424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Complemental strand, 45481548 - 45481517
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45481548 |
gaaccccggaccttgcatatattatgcattgt |
45481517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 46707931 - 46707896
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46707931 |
gtttgaaccccggaacttgcatatattatgcattgt |
46707896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 48646716 - 48646763
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48646716 |
tggtggccggagtttgaaccccggaccttgcatattattatgcattgt |
48646763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Complemental strand, 49222875 - 49222840
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49222875 |
gtttgaaccccggaccttgcatatattgtgcattgt |
49222840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 64669 - 64715
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
64669 |
tggtggacgaggtttgaactccggactttgcatatattatgcattgt |
64715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 127144 - 127098
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
127144 |
tggtggccgggatttaaaccccggaccttgcatatataatgcattgt |
127098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 1091249 - 1091203
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| | |||||||||||| |||||||||| |||||||||||| |
|
|
| T |
1091249 |
tggtggtcagagtttgaaccccgaaccttgcatacattatgcattgt |
1091203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 5279361 - 5279407
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| || ||| |||||||||||||||||||| |
|
|
| T |
5279361 |
tggtggtcgaggtttgaactccagacattgcatatattatgcattgt |
5279407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8210376 - 8210422
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
8210376 |
tggtggccggggttcgaaccctggaccttgtatatattatgcattgt |
8210422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 9929230 - 9929268
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
9929230 |
ggggttttaaccctggaccttgcatatattatgcattgt |
9929268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 10293006 - 10292960
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
10293006 |
tggtggtcggggtttaaaccccgtcccttacatatattatgcattgt |
10292960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 10356174 - 10356220
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
10356174 |
tggtggccggagttcgaaccccggaccgtgcatatattatgcattgt |
10356220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11181926 - 11181972
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
11181926 |
tggtggccggggtttgaaccccgcaccttgcatatttcatgcattgt |
11181972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12522110 - 12522156
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||| |||| |
|
|
| T |
12522110 |
tggtggtcggggtttgaacctcagaccttgtatatattatgcgttgt |
12522156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16967185 - 16967231
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16967185 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcattgt |
16967231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 17221519 - 17221557
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
17221519 |
ggggttcgaacctcggaccttgcatatattatgcattgt |
17221557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 17669715 - 17669669
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
17669715 |
tggtggccggagtttgaaccccgaaccttgcatatattatacattgt |
17669669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 17917129 - 17917175
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||| ||||||||||| |
|
|
| T |
17917129 |
tggtggtcggggtttgaatcccgaaccttacatattttatgcattgt |
17917175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Complemental strand, 19620634 - 19620600
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19620634 |
tttgaaccccggaccttgcatatattatgtattgt |
19620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Complemental strand, 22346744 - 22346702
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||| |
|
|
| T |
22346744 |
gtggtcaggatttgaaccccggaccttgcatattttatgcatt |
22346702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 26010292 - 26010246
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
26010292 |
tggtggtcagggtttgaaccccgaaccttgcatgtattatacattgt |
26010246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28712527 - 28712572
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
28712527 |
tggtgatcggggtttgaactccg-accttgcatatattatgcattgt |
28712572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 29233965 - 29234011
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| ||||||||||| |
|
|
| T |
29233965 |
tggtggttggggttcgaaccccagaccttgcatattttatgcattgt |
29234011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 29987103 - 29987149
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
29987103 |
tggtggttggggttcgaactccagaccttgcatatattatgcattgt |
29987149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 32864362 - 32864316
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| | | ||||||||||| |||||||||||||||||||| |
|
|
| T |
32864362 |
tggtggtcggagctcgaaccccggactttgcatatattatgcattgt |
32864316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 33020042 - 33020080
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
33020042 |
ggggtttgaacctcagaccttgcatatattatgcattgt |
33020080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 455
Target Start/End: Original strand, 33206799 - 33206841
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
33206799 |
gtggtcggagtttgaaccccagaccttggatatattatgcatt |
33206841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 37045145 - 37045183
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
37045145 |
ggggttcgaaccctggaccttgcatatattatgcattgt |
37045183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 39949882 - 39949836
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| || ||||||| ||||||| |||||||||||||||| |
|
|
| T |
39949882 |
tggtggtcgggattcgaaccccagaccttgtatatattatgcattgt |
39949836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 40227899 - 40227853
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||| ||||||||||| |
|
|
| T |
40227899 |
tggtggtcggggttcgaaccccagaccttgtatattttatgcattgt |
40227853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 40411744 - 40411790
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||| |||||| ||||| |
|
|
| T |
40411744 |
tggtggtcggggtttgaaccctggaccttacatacattatgtattgt |
40411790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 40734996 - 40735042
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
40734996 |
tggtggtcagggtttgaaccccgaaccttacatattttatgcattgt |
40735042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 41884796 - 41884842
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
41884796 |
tggtggccggggttcgaaccccggaccttgtatatattatgtattgt |
41884842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 42888637 - 42888599
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
42888637 |
ggggttcgaaccccggaccttgcatattttatgcattgt |
42888599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 43356505 - 43356459
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
43356505 |
tggtggtcggggtttgaactccaaaccttacatatattatgcattgt |
43356459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 44243943 - 44243897
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
44243943 |
tggtggttggggtttgaactctggaccttacatatattatgcattgt |
44243897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Complemental strand, 44641585 - 44641551
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
44641585 |
tttgaaccccgggccttgcatatattatgcattgt |
44641551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 44678020 - 44678054
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcattgt |
44678054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 45139997 - 45140043
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
45139997 |
tggtggccggggtttaaactctggaccttgcatatattatgcattgt |
45140043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 48681924 - 48681970
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
48681924 |
tggtggtcggagtttgagctccgaaccttgcatatattatgcattgt |
48681970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 50638907 - 50638953
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
50638907 |
tggtggccgggattcgaaccctggaccttgcatatattatgcattgt |
50638953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 52441502 - 52441548
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
52441502 |
tggtggccggggttcaaacgccggaccttgcatatattatgcattgt |
52441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 17284012 - 17283975
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
17284012 |
gggttcgaaccctggaccttgcatatattatgcattgt |
17283975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 23981065 - 23981102
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
23981065 |
gggttcgaaccccggacattgcatatattatgcattgt |
23981102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 455
Target Start/End: Complemental strand, 29800600 - 29800559
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
29800600 |
tggttggggtttgaacccccgaccttgcatattttatgcatt |
29800559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 423 - 456
Target Start/End: Complemental strand, 30521925 - 30521892
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattg |
456 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
30521925 |
tttgaatcccggaccttgcatatattatgcattg |
30521892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 32497481 - 32497518
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32497481 |
gggtttgaaccctagaccttgcatatattatgcattgt |
32497518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 45190269 - 45190306
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45190269 |
gggtttgaatcccgaaccttgcatatattatgcattgt |
45190306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 50040417 - 50040380
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
50040417 |
gggtttgaaccctggaccttgcatattttatgcattgt |
50040380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 1755137 - 1755093
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
1755137 |
gtggtcagggtttgaacccgagaccttgcatatattatgcgttgt |
1755093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 2613790 - 2613746
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||| ||||||||||| |
|
|
| T |
2613790 |
gtggtcggggttcgaaccccgaaccttacatattttatgcattgt |
2613746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 429 - 457
Target Start/End: Original strand, 3509950 - 3509978
Alignment:
| Q |
429 |
ccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3509950 |
ccccggaccttgcatatattatgcattgt |
3509978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 3693789 - 3693833
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| | |||||| |||||||||||| |||| |
|
|
| T |
3693789 |
gtggtcggggtttgaacctcagaccttacatatattatgctttgt |
3693833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 4302516 - 4302476
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4302516 |
tcgggatttgaactccggatcttgcatatattatgcattgt |
4302476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 7550964 - 7550920
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||| ||||||||||| |
|
|
| T |
7550964 |
gtggtcggggttcgaatcccggaccttgtatattttatgcattgt |
7550920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 9528065 - 9528021
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||| ||||| |
|
|
| T |
9528065 |
gtggtcggggtttgaacctcgaaccttgcatattttatgtattgt |
9528021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 9639818 - 9639854
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
9639818 |
ggttcgaactccggaccttgcatatattatgcattgt |
9639854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 10132445 - 10132481
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
10132445 |
ggttcgaaccccagaccttgcatatattatgcattgt |
10132481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 13054941 - 13054897
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
13054941 |
gtggtcgaggttcgaacctccgaccttgcatatattatgcattgt |
13054897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 16966963 - 16967007
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||| ||||||||| || ||||||||||||||||||||| |
|
|
| T |
16966963 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 17537755 - 17537711
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
17537755 |
gtggccggggtttgaacaccggatcttgtatatattatgcattgt |
17537711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 18043500 - 18043461
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18043500 |
tggtggtcggggtttgaa-cccagaccttgcatatattatg |
18043461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 18186747 - 18186711
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatat |
447 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
18186747 |
tggtggttggggtttgaaccccgaaccttgcatatat |
18186711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 20415639 - 20415679
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
20415639 |
tggtggtcgaggtttgaatcacggaccttgcatatattatg |
20415679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 26998672 - 26998628
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| || | ||||||| ||||||||||| |
|
|
| T |
26998672 |
gtggtcggggtttgaaccccagatcctgcatatcttatgcattgt |
26998628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 31338089 - 31338045
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| ||||||| |||| |||||| |||||||||||||| |
|
|
| T |
31338089 |
tggtggtcggagtttgaatcccgcaccttgtatatattatgcatt |
31338045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 410 - 450
Target Start/End: Original strand, 33382248 - 33382288
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
|||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
33382248 |
ttggtggtcggggtttgaacaccagaccttacatatattat |
33382288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 443
Target Start/End: Original strand, 36260991 - 36261023
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcat |
443 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
36260991 |
tggtggtcggggtttgaatcccggaccttgcat |
36261023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 41974831 - 41974787
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
41974831 |
tggtggccggggtttgaacctcaaaccttgcatatattatgcatt |
41974787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 43896814 - 43896858
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||||||||||||||| |
|
|
| T |
43896814 |
gtggtcggggttcgaatcccgaactttgcatatattatgcattgt |
43896858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 454
Target Start/End: Complemental strand, 44068989 - 44068949
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
44068989 |
tggtcggtgttcgaactccggaccttgcatatattatgcat |
44068949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 44860876 - 44860920
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
44860876 |
gtggccggggtttgaaccccagaccttggatattttatgcattgt |
44860920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 47417843 - 47417807
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
47417843 |
ggtttgaactccgaaccttgcatatattatgcattgt |
47417807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 48103205 - 48103162
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||| ||||||| |
|
|
| T |
48103205 |
gtggtcggggttcgaaccc-ggaccttgcatatattaagcattgt |
48103162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 49798308 - 49798344
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |
|
|
| T |
49798308 |
ggtttgaaccccgaacattgcatatattatgcattgt |
49798344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 51067885 - 51067925
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
51067885 |
tggtggtcgggatttgaaccccgagccttgcatatattatg |
51067925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 52043343 - 52043299
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||| ||||||||| |
|
|
| T |
52043343 |
tggtggtcgggatttgaaccccgaacattgcatattttatgcatt |
52043299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 52086177 - 52086145
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatat |
445 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
52086177 |
gtggtcggggtttgaaccccggatcttgcatat |
52086145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 52267832 - 52267788
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
52267832 |
gtggtcgggatttgaatcccagaccttgcatattttatgcattgt |
52267788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 117)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 12748971 - 12748925
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12748971 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
12748925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12800891 - 12800937
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12800891 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
12800937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19163527 - 19163573
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19163527 |
tggtggtcggggtttgaaccccggaccttgcataaattatgcattgt |
19163573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 32051523 - 32051569
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32051523 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
32051569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 24023408 - 24023452
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24023408 |
gtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 23159512 - 23159465
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
23159512 |
ttggtggtcggggtttgaaccccgaatcttgcatatattatgcattgt |
23159465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 27718884 - 27718931
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27718884 |
ttggtggtcggagtttgaactccggaccttgcatatattatgcattgt |
27718931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 444483 - 444437
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
444483 |
tggtggccggggtttaaaccccggaccttgcatatattatgcattgt |
444437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 7997010 - 7996964
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7997010 |
tggtggtcggggtttgaaccccagaccttgcatatattatgcgttgt |
7996964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8881345 - 8881299
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8881345 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgt |
8881299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 11709056 - 11709010
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgt |
11709010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14598189 - 14598235
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14598189 |
tggtggtcggggtttgaaccccgcaccttgcttatattatgcattgt |
14598235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 18533739 - 18533693
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18533739 |
tggtggttggggtttgaaccccggatcttgcatatattatgcattgt |
18533693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 19260570 - 19260616
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19260570 |
tggtggccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 24838161 - 24838207
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24838161 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
24838207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 27587291 - 27587245
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27587291 |
tggtggccggggtttgaaccccggaccttgcatatatcatgcattgt |
27587245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 33105453 - 33105415
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33105453 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
33105415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 8461829 - 8461873
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
8461829 |
gtggtcggggtttgaactccggaccttgcatattttatgcattgt |
8461873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 8999882 - 8999926
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
8999882 |
tggtggtcggggtttgaaccctggactttgcatatattatgcatt |
8999926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 11053044 - 11053000
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcattgt |
11053000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 418 - 454
Target Start/End: Original strand, 30176417 - 30176453
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30176417 |
cggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 13124361 - 13124400
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13124361 |
cggggtttgaaccccggaccttgcatattttatgcattgt |
13124400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 26799255 - 26799208
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
26799255 |
ttggtggtcggggttttaaccccgaaccttgcatattttatgcattgt |
26799208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 27571839 - 27571886
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27571839 |
ttggtggtcgggatttgaaccccaaaccttgcatatattatgcattgt |
27571886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 6471581 - 6471535
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6471581 |
tggtggccggggtttgaaccccgaacattgcatatattatgcattgt |
6471535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8717466 - 8717512
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgt |
8717512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 20665354 - 20665400
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
20665354 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
20665400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 22775698 - 22775652
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22775698 |
tggtggccagggtttgaaccccggaccttgcataaattatgcattgt |
22775652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 26932754 - 26932800
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
26932754 |
tggtggtcgtggtttgaaccctggaccttgcatatatcatgcattgt |
26932800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29376971 - 29376925
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
29376971 |
tggtggtcggggtttgaactccagaccttgcatatattacgcattgt |
29376925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29652288 - 29652242
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcattgt |
29652242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 30550717 - 30550763
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
30550717 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
30550763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 32944831 - 32944877
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
32944831 |
tggtggtcggggtttgaacctcagaccttgcatattttatgcattgt |
32944877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 33996139 - 33996093
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
33996139 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgt |
33996093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 37141427 - 37141381
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37141427 |
tggtggccggagtttgaaccccgaaccttgcatatattatgcattgt |
37141381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 42172234 - 42172280
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
42172234 |
tggtggttggggtttgaactccggatcttgcatatattatgcattgt |
42172280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 44215466 - 44215512
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44215466 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
44215512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 44632176 - 44632222
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
44632176 |
tggtggtcggggtttgaaccccgaaccttatatatattatgcattgt |
44632222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 24195318 - 24195273
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24195318 |
ggtgatcggagtttgaaccccggaccttgcatatattatgtattgt |
24195273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 416 - 457
Target Start/End: Original strand, 31336803 - 31336844
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31336803 |
gtcggggtttgaaccctagaccttgcatatattatgcattgt |
31336844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 416 - 457
Target Start/End: Complemental strand, 32192959 - 32192918
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
32192959 |
gtcggggttcgaaccccgaaccttgcatatattatgcattgt |
32192918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 34645078 - 34645123
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcata-tattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcattgt |
34645123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 36781477 - 36781432
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
36781477 |
ggtggtcggggtttaaaccccggactttgcatatattatgtattgt |
36781432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 39821945 - 39821908
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgt |
39821908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 44794962 - 44794917
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| || ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcattgt |
44794917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 3650590 - 3650546
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3650590 |
tggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 4830076 - 4830032
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcattgt |
4830032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 10871895 - 10871931
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10871895 |
ggtttgaaccccggaccttgcatacattatgcattgt |
10871931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 15147020 - 15147060
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
15147020 |
tggtggtcgggatttgagccccggaccttgcatatattatg |
15147060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 24023699 - 24023743
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| |||| |
|
|
| T |
24023699 |
tggtggtcggggtttgaaccccggaccttgcagacattatacatt |
24023743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 30623357 - 30623317
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
30623357 |
tcggggttcgaaccccagaccttgcatatattatgcattgt |
30623317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 42208470 - 42208506
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatgcattgt |
42208506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 454
Target Start/End: Original strand, 6235542 - 6235585
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||| ||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
6235542 |
tggtggccggggtttgaatcccggaccttacatatattatgcat |
6235585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 7869639 - 7869678
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7869639 |
cggggtttgaacccccaaccttgcatatattatgcattgt |
7869678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Complemental strand, 19778120 - 19778089
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcattgt |
19778089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 26196594 - 26196641
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
26196594 |
ttggtggccggagtttgaaccacgaaccttgcatatattatgcattgt |
26196641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 29546963 - 29546924
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29546963 |
tggtggtcagggtttgaaccccagaccttgcatatattat |
29546924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Original strand, 44084262 - 44084308
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44084262 |
ttggtggccgaggtttgaaccc-ggaccttgcatatattatgcattgt |
44084308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 4077751 - 4077713
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
4077751 |
ggggtttgaaccccgaaccttgcatatattatgaattgt |
4077713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Complemental strand, 6447247 - 6447213
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcattgt |
6447213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 9192218 - 9192264
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||||| ||| || ||||||||||||||||| |
|
|
| T |
9192218 |
tggtggccggggtttgaaccccagactttacatatattatgcattgt |
9192264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 9241085 - 9241039
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
9241085 |
tggtggccggggtttgaacatcggaccttacatatattatgcattgt |
9241039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 9478026 - 9478072
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
9478026 |
tggtggtcagggtttgatccccagaccttgcatacattatgcattgt |
9478072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11603828 - 11603874
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
11603828 |
tggtggtcgaggtttgaactcccaaccttgcatatattatgcattgt |
11603874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 12714373 - 12714407
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcattgt |
12714407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 13357432 - 13357478
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||| || ||||||||||||||||||||||| |
|
|
| T |
13357432 |
tggtggccgaggtttgaacctcgtaccttgcatatattatgcattgt |
13357478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 15001266 - 15001312
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
15001266 |
tggtggccggggtttgaaccttggaccttgcatattttatgcattgt |
15001312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15020831 - 15020785
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
15020831 |
tggtggccagggtttgaaccccggatcttgcatatattatacattgt |
15020785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 427 - 457
Target Start/End: Complemental strand, 15438507 - 15438477
Alignment:
| Q |
427 |
aaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcattgt |
15438477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 427 - 457
Target Start/End: Complemental strand, 15529811 - 15529781
Alignment:
| Q |
427 |
aaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcattgt |
15529781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 18422444 - 18422490
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
18422444 |
tggtggttggggtttgaatcccgaaccttacatatattatgcattgt |
18422490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 20275188 - 20275226
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
20275188 |
ggggtttgaaccccgaaccttgcatgtattatgcattgt |
20275226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 21061815 - 21061853
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
21061815 |
ggggtttgaaccccgaaccttgcatgtattatgcattgt |
21061853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 21557503 - 21557457
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| || ||||| |||||||| ||||||||||||||||| |
|
|
| T |
21557503 |
tggtggtcgggattcgaacctcggaccttacatatattatgcattgt |
21557457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 427 - 457
Target Start/End: Original strand, 22948088 - 22948118
Alignment:
| Q |
427 |
aaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22948088 |
aaccccggaccttgcatatattatgcattgt |
22948118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 26991748 - 26991794
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26991748 |
tggtggtcgtggtttgaaccacaaaccttgcatatattatgcattgt |
26991794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 27134411 - 27134457
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
27134411 |
tggttgtcggagtttgaaccccggactttgcatatattatacattgt |
27134457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 455
Target Start/End: Complemental strand, 28440023 - 28439985
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
28440023 |
tcggggtttgaaccccagaccttacatatattatgcatt |
28439985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 29716691 - 29716737
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
29716691 |
tggtggccggagtttgaatcccggaccttgcatatattatgaattgt |
29716737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 29924916 - 29924954
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
29924916 |
ggggtttaaaccccgaaccttgcatatattatgcattgt |
29924954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 30218273 - 30218227
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||| ||| |||||| |||||||||||||||||||| |
|
|
| T |
30218273 |
tggttgtcggggtttaaactccggacattgcatatattatgcattgt |
30218227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 30417601 - 30417647
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||| |||||| |
|
|
| T |
30417601 |
tggtggacggggtttgaaccccgaaccatgcatatattatacattgt |
30417647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 453
Target Start/End: Original strand, 32286355 - 32286397
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
32286355 |
tggtggccggggtttgaaccccgaatcttgcatatattatgca |
32286397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 420 - 450
Target Start/End: Complemental strand, 32421630 - 32421600
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32421630 |
gggtttgaaccccggaccttgcatatattat |
32421600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 35700386 - 35700432
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
35700386 |
tggtggtcggagtttgaaccccgaattttgcatatattatgcattgt |
35700432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 37749990 - 37750036
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
37749990 |
tggtggccggggttcaaaccccggactttgcatatattatgcattgt |
37750036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 38763506 - 38763552
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| | ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
38763506 |
tggtggccagggttcgaaccccagaccttgcatatattatgcattgt |
38763552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 39076590 - 39076544
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
39076590 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
39076544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 39077076 - 39077030
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
39077076 |
tggtgatcagggttcgaaccccggaccttgcatattttatgcattgt |
39077030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 40167392 - 40167346
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
40167392 |
tggtggccggggtttgaatcccgaaccttgtatatattatgcattgt |
40167346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 43778089 - 43778043
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
43778089 |
tggtggtcggagtttgaacctcagaccttgcatattttatgcattgt |
43778043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 1921785 - 1921744
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatata-ttatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
1921785 |
tcggggttcgaaccccggaccttgcatatatttatgcattgt |
1921744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 457
Target Start/End: Original strand, 9655989 - 9656034
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
9655989 |
ggtggttggggttcgaacctcggaccttgcatattttatgcattgt |
9656034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 13286199 - 13286155
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13286199 |
ggtggccggggtttgaaccc-ggatcttgcatatattatgcattgt |
13286155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 455
Target Start/End: Complemental strand, 18942981 - 18942944
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
18942981 |
cggggtttgaaacccggaccatgcatatattatgcatt |
18942944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 410 - 455
Target Start/End: Original strand, 24338194 - 24338239
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
24338194 |
ttggtggtcggggtttgaacttcagaccttgcatattttatgcatt |
24338239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 450
Target Start/End: Complemental strand, 34438472 - 34438435
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
34438472 |
gtggtcggggtttcaaccccggaccttgcatattttat |
34438435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 418 - 451
Target Start/End: Original strand, 36428692 - 36428725
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
36428692 |
cggggtttgaacccctgaccttgcatatattatg |
36428725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 455
Target Start/End: Complemental strand, 37938562 - 37938521
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
37938562 |
tggtcgggatttgaacctcggactttgcatatattatgcatt |
37938521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 41603122 - 41603085
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
41603122 |
gggtttgaaccccagaccttacatatattatgcattgt |
41603085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 3672609 - 3672653
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3672609 |
gtggtcggggtttgaaccctaaaccttgcatattttatgcattgt |
3672653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 8072788 - 8072752
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
8072788 |
ggttcgaaccccggaccttgtatatattatgcattgt |
8072752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 439
Target Start/End: Original strand, 10171561 - 10171589
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggacctt |
439 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10171561 |
tggtggtcggggtttgaaccccggacctt |
10171589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 10601831 - 10601787
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
10601831 |
gtggccggggtttgaatcccgaatcttgcatatattatgcattgt |
10601787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Complemental strand, 10752479 - 10752443
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatat |
447 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10752479 |
tggtggtcggggtttgaaccccagaccttgaatatat |
10752443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 11040412 - 11040456
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
11040412 |
gtggtcggggtttgaacttcggaccttacatattttatgcattgt |
11040456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 13105154 - 13105118
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
13105154 |
ggttcgaaccccggcccttgcatatattatgcattgt |
13105118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 17898149 - 17898109
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
17898149 |
tggtggccggggttagaatcccggaccttgcatatattatg |
17898109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 18638168 - 18638124
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
18638168 |
gtggtcggggtttgaaccccatactttgcatattttatgcattgt |
18638124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 21589202 - 21589238
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
21589202 |
ggtttgaatcccggaccttccatatattatgcattgt |
21589238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 457
Target Start/End: Original strand, 22504287 - 22504327
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
22504287 |
tcggagtttgaaccccgaaccttgcatattttatgcattgt |
22504327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 24695999 - 24696043
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
24695999 |
gtggtcagggtttgaatctcggatcttgcatatattatgcattgt |
24696043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 419 - 455
Target Start/End: Original strand, 25277215 - 25277251
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
25277215 |
ggggttcgaaccccggaccttgcatattttatgcatt |
25277251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 453
Target Start/End: Original strand, 27750905 - 27750937
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgca |
453 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
27750905 |
ggttcgaaccccggaccttgcatatattatgca |
27750937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 28581014 - 28580970
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
28581014 |
tggtggtcgggatttgaaccccgaaccttacatattttatgcatt |
28580970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Original strand, 32115407 - 32115443
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32115407 |
ggtttgaaccccgaaccttacatatattatgcattgt |
32115443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 39138989 - 39139033
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
39138989 |
tggtggtcggagtttgaaccccgaaccttacatattttatgcatt |
39139033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 87)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 8569779 - 8569733
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8569779 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgt |
8569733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15187133 - 15187087
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15187133 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcattgt |
15187087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 15473473 - 15473519
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15473473 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcattgt |
15473519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Complemental strand, 20744206 - 20744162
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcattgt |
20744162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 34481407 - 34481451
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34481407 |
gtggtcggggtttgaaccccggaccttgcatatataatgcattgt |
34481451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 13496183 - 13496140
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13496183 |
tggtcggggtttgaactccggaccttgcatatattatgcattgt |
13496140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 33824952 - 33824905
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824952 |
ttggtggccgaggtttgaaccccggaccttgcatatattatgcattgt |
33824905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 788936 - 788890
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
788936 |
tggtggtcggggtttgaactccgaaccttgcatatattatgcattgt |
788890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 4455587 - 4455633
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
4455587 |
tggtggtcggggtttgaaccccagaccttgcatatattatgccttgt |
4455633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8629687 - 8629733
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8629687 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgt |
8629733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15155805 - 15155759
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15155805 |
tggtggtcgtggtttgaaccccagaccttgcatatattatgcattgt |
15155759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15170001 - 15169955
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15170001 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 15178773 - 15178727
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15178773 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15178727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 16204781 - 16204827
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
16204781 |
tggtggtcgggatttgaaccccggaccttgcatacattatgcattgt |
16204827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 24623308 - 24623354
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
24623308 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
24623354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29740552 - 29740506
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29740552 |
tggtggccggggtttgaaccccggaccttgcgtatattatgcattgt |
29740506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 655742 - 655786
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcattgt |
655786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 2546250 - 2546210
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2546250 |
tggtggtcggggtttgaaccccgtaccttgcatatattatg |
2546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 9111111 - 9111071
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9111111 |
tcggggttcgaaccccggaccttgcatatattatgcattgt |
9111071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 9977127 - 9977083
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9977127 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcatt |
9977083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 14918293 - 14918337
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
14918293 |
gtggtcggggtttgaaccccagaccttgtatatattatgcattgt |
14918337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 419 - 454
Target Start/End: Complemental strand, 291429 - 291394
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
291429 |
ggggtttgaaccccggaccttgcatatattatgcat |
291394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Original strand, 2726415 - 2726454
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2726415 |
cggggttcgaaccccggaccttgcatatattatgcattgt |
2726454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 414 - 457
Target Start/End: Complemental strand, 8809373 - 8809330
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
8809373 |
tggtcggggtttgaacctcggatcttgcatatattatgcattgt |
8809330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 16390500 - 16390453
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| || ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16390500 |
ttggtggccgaggtttgaaccccggaccttacatatattatgcattgt |
16390453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 411 - 454
Target Start/End: Complemental strand, 32621442 - 32621399
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
32621442 |
tggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 33976307 - 33976268
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33976307 |
cggggtttgaaccccggaccttgcatattttatgcattgt |
33976268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 247729 - 247683
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
247729 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgt |
247683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 9367471 - 9367425
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
9367471 |
tggtggtcggggtttgaatcccagaccttgcatattttatgcattgt |
9367425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 423 - 457
Target Start/End: Complemental strand, 12215811 - 12215777
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
12215811 |
tttgaaccccggaccttgcatatattatgcattgt |
12215777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 18253338 - 18253376
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18253338 |
ggggtttgaaccctggaccttgcatatattatgcattgt |
18253376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 23903298 - 23903344
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
23903298 |
tggtggtcggtgtttgaaccccgaacgttgcatatattatgcattgt |
23903344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 24373709 - 24373747
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24373709 |
ggggtttgaacccctgaccttgcatatattatgcattgt |
24373747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 27080689 - 27080735
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
27080689 |
tggtggtcggggtttgaatcccagagcttgcatatattatgcattgt |
27080735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 27834409 - 27834363
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27834409 |
tggtggtccgggtttgaaccccagaccttgcatatattatgccttgt |
27834363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28231416 - 28231462
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
28231416 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcattgt |
28231462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 28758281 - 28758327
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
28758281 |
tggtgttcggggtttgaacctcggactttgcatatattatgcattgt |
28758327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 32524411 - 32524457
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
32524411 |
tggtggttggggtttgaaccctggactttgcatatattatgcattgt |
32524457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 8637437 - 8637474
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcattgt |
8637474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 413 - 450
Target Start/End: Original strand, 22792933 - 22792970
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22792933 |
gtggtcggggtttgaaccccggaccttacatatattat |
22792970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 412 - 457
Target Start/End: Complemental strand, 28898925 - 28898880
Alignment:
| Q |
412 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgt |
28898880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 31971590 - 31971553
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31971590 |
gggtttgaacctcggaccttgcatatattatgcattgt |
31971553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 9392659 - 9392703
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
9392659 |
tggtagtcggggtttaaacctcggaccttgcatatattatgcatt |
9392703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 12184578 - 12184534
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
12184578 |
tggtggccgggatttgaaccacggaccttgcatatattatgcatt |
12184534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 26356074 - 26356118
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcattgt |
26356118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 26400936 - 26400888
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
26400936 |
gttggtggccggggttcaaaccccggaccttgcatatattatgtattgt |
26400888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 27907942 - 27907986
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27907942 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 29680658 - 29680614
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29680658 |
tggtggtcggagtttgaacaccgaaccttgcatatattatgcatt |
29680614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 32053860 - 32053812
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| ||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
32053860 |
gttggtggccggagtttgaaccacgaaccttgcatatattatgcattgt |
32053812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 426 - 457
Target Start/End: Complemental strand, 4450317 - 4450286
Alignment:
| Q |
426 |
gaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4450317 |
gaaccccggaccttgcatatattatgcattgt |
4450286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 12440733 - 12440694
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
12440733 |
tggtggtcgaggtttgaaccccagaccttgcatatattat |
12440694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 457
Target Start/End: Original strand, 19265526 - 19265561
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19265526 |
gtttgaaccccggaccttgcatattttatgcattgt |
19265561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 34474298 - 34474251
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
34474298 |
ttggtggccggggttcgaaccatggaccttgcatatattatgcattgt |
34474251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 2445369 - 2445323
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| |||||||| | |||| |||||||||||||||| |
|
|
| T |
2445369 |
tggtggtcggggttcgaaccccgaatcttgtatatattatgcattgt |
2445323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 3808117 - 3808155
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
3808117 |
ggggtttgaatctcggaccttgcatatattatgcattgt |
3808155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 449
Target Start/End: Complemental strand, 5267094 - 5267056
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
449 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5267094 |
tggtggtcggggtttgaattccggaccttgcatatatta |
5267056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 8138449 - 8138495
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| | |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
8138449 |
tggtggttgaggtttgaaccccagaccttacatatattatgcattgt |
8138495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 11456367 - 11456412
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11456367 |
tggtggccggggtttgaaccccg-accttacatatattatgcattgt |
11456412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12232173 - 12232219
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
12232173 |
tggtggtcggggttcgaaccccagacactgcatatattatgcattgt |
12232219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12323481 - 12323527
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||| | |||||| |||||||||||||||| |
|
|
| T |
12323481 |
tggtggtcggtgtttgaaccctgaaccttgtatatattatgcattgt |
12323527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12582220 - 12582266
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
12582220 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgt |
12582266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 12591018 - 12591064
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
12591018 |
tggtggttggggtttaaatcccgaaccttgcatatattatgcattgt |
12591064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 12808931 - 12808893
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
12808931 |
ggggttcgaaccccagaccttgcatatattatgcattgt |
12808893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14296948 - 14296994
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
14296948 |
tggtggccggggtttgaaccccggaccttacatattttatgtattgt |
14296994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 17113451 - 17113497
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
17113451 |
tggtggtcgaagtttgaacctcagaccttgcatatattatgcattgt |
17113497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 17151306 - 17151260
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
17151306 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgt |
17151260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 17935799 - 17935753
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||||||||| |
|
|
| T |
17935799 |
tggtggtcgggatttgaaccctagaccttgcatattttatgcattgt |
17935753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 452
Target Start/End: Original strand, 17992344 - 17992382
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgc |
452 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17992344 |
tggtcggggttcaaaccccggaccttgcatatattatgc |
17992382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 21599027 - 21598981
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
21599027 |
tggtggccggggtttaaaccccgtaccttgcatatattatgtattgt |
21598981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 26548313 - 26548275
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
26548313 |
ggggtttgaaccccgaaccttgcatatattatacattgt |
26548275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 27080795 - 27080841
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
27080795 |
tggtggtcggggtttgaattccagagcttgcatatattatgcattgt |
27080841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 29283885 - 29283839
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29283885 |
tggtggtcggagtttgaaccctagaccttgcatatattatacattgt |
29283839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 34701217 - 34701171
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| ||||||||| | |||||||||||||||||||||||| |
|
|
| T |
34701217 |
tggtggccggagtttgaacctcagaccttgcatatattatgcattgt |
34701171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 457
Target Start/End: Original strand, 8130455 - 8130496
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
8130455 |
gtcggggtttgaatctcggaccttgcatattttatgcattgt |
8130496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 455
Target Start/End: Complemental strand, 8639105 - 8639072
Alignment:
| Q |
422 |
gtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
8639105 |
gtttgaaccccggaccttgcatatactatgcatt |
8639072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 424 - 457
Target Start/End: Complemental strand, 8831264 - 8831231
Alignment:
| Q |
424 |
ttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
8831264 |
ttgaaccccggaccttgcataaattatgcattgt |
8831231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 457
Target Start/End: Original strand, 18254097 - 18254138
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
18254097 |
gtcggggttcgaatcccggaccttgcatgtattatgcattgt |
18254138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 454
Target Start/End: Original strand, 866279 - 866319
Alignment:
| Q |
414 |
tggtcggggtttgaaccccggaccttgcatatattatgcat |
454 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
866279 |
tggtcggggtttgaaccatgaaccttgcatatattatgcat |
866319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 2655020 - 2655064
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
2655020 |
gtggccggggtttgaaccccggatcttacatattttatgcattgt |
2655064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 3358451 - 3358415
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
3358451 |
ggtttgaacctcggactttgcatatattatgcattgt |
3358415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 5040824 - 5040864
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5040824 |
tggtggccggagtttgaacaccggaccttgcatatattatg |
5040864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 10018469 - 10018425
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| ||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10018469 |
tggtggccggagtttgaaccccgaaccttacatatattatgcatt |
10018425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 13583619 - 13583575
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||| | || |||||||||||||| |||| |
|
|
| T |
13583619 |
tggtggtcggggtttgaacctctgagcttgcatatattatacatt |
13583575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 457
Target Start/End: Original strand, 14772979 - 14773019
Alignment:
| Q |
417 |
tcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
14772979 |
tcggggtttgaatccccgaccttggatatattatgcattgt |
14773019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 423 - 455
Target Start/End: Original strand, 21029369 - 21029401
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
21029369 |
tttgaaccccgaaccttgcatatattatgcatt |
21029401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Complemental strand, 24248235 - 24248195
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||| || |||||||||||||||| ||||||||||| |
|
|
| T |
24248235 |
tggtggtcgagggttgaaccccggaccttacatatattatg |
24248195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 447
Target Start/End: Original strand, 28989302 - 28989338
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatat |
447 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
28989302 |
tggtggtcggggttcgaaccccgtaccttgcatatat |
28989338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 410 - 457
Target Start/End: Complemental strand, 64289 - 64242
Alignment:
| Q |
410 |
ttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
64289 |
ttggtggtcggggttcgaatcccggaccttgcatatattatgcattgt |
64242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 1164 - 1202
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
1202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 53371 - 53417
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
53371 |
tggtggtcggggtttgaaccccagaccttgcatattttatgcattgt |
53417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 161211 - 161165
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
161211 |
tggtggtcggggtttgaaccccgaaccttgcatattttatgcattgt |
161165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1619 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold1619
Description:
Target: scaffold1619; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 1093 - 1055
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1093 |
ggggtttgaatcccggaccttgcatatattatgcattgt |
1055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 5252 - 5206
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
5252 |
tggtggttggggtttgaacctcagaccttgcatatattatgcattgt |
5206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14177 - 14223
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14177 |
tggtggtcggggtttgaaccacataccttgcatatattatgcattgt |
14223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 31913 - 31959
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
31913 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcattgt |
31959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 75395 - 75349
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
75395 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
75349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 99107 - 99061
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
99107 |
tggttgtcggagtttgaaccccagaccttgcatatattatgcattgt |
99061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.0000000002; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 7792 - 7746
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
7792 |
tggtggtcggggtttgaacctcggaccttgcatgttttatgcattgt |
7746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 185326 - 185287
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
185326 |
cggggtttgaaccccggatcttgcatattttatgcattgt |
185287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Original strand, 189972 - 190009
Alignment:
| Q |
420 |
gggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
189972 |
gggtttgaaccccgaaccttacatatattatgcattgt |
190009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 416 - 457
Target Start/End: Original strand, 72771 - 72812
Alignment:
| Q |
416 |
gtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
72771 |
gtcggagtttgaaccctggaccttgcatatattatgcattgt |
72812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 409 - 457
Target Start/End: Complemental strand, 48719 - 48671
Alignment:
| Q |
409 |
gttggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||| ||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
48719 |
gttggtgtccggggtttgaatcccggactttgcatatattatgcattgt |
48671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 22974 - 22935
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
22974 |
cggggtttgaacctcggaccttgcatattttatgcattgt |
22935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 450
Target Start/End: Complemental strand, 53495 - 53456
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattat |
450 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
53495 |
tggtggtcggggtttgaatcccggaccttgcatatgttat |
53456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 418 - 457
Target Start/End: Complemental strand, 239870 - 239831
Alignment:
| Q |
418 |
cggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
239870 |
cggggtttgaactccggactttgcatatattatgcattgt |
239831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1120 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold1120
Description:
Target: scaffold1120; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 1975 - 1937
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
1975 |
ggggtttgaaccacgaaccttgcatatattatgcattgt |
1937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 1590 - 1552
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
1590 |
ggggttcgaaccccggaccttgcatattttatgcattgt |
1552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 14807 - 14853
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
14807 |
tggtggccggggttcaaaccccggaccttgcatattttatgcattgt |
14853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Original strand, 15929 - 15967
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
15929 |
ggggtttgaaccccagaccttgcatatattatacattgt |
15967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 5483 - 5437
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||||| ||||||||||| |
|
|
| T |
5483 |
tggtggtcggggatcgaaccccagaccttgcatattttatgcattgt |
5437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 419 - 457
Target Start/End: Complemental strand, 25451 - 25413
Alignment:
| Q |
419 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
25451 |
ggggttcgaaccctggaccttgcatatattatgcattgt |
25413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 37605 - 37559
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||| |||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
37605 |
tggtggccgggattcgaaccccggaccttgcatattttatgcattgt |
37559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Complemental strand, 40381 - 40335
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
40381 |
tggtggtcggagtttgaacctcggaccatgcatattttatgcattgt |
40335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 423 - 457
Target Start/End: Original strand, 42337 - 42371
Alignment:
| Q |
423 |
tttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
42337 |
tttgaaccccagaccttgcatatattatgcattgt |
42371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 415 - 457
Target Start/End: Original strand, 91174 - 91216
Alignment:
| Q |
415 |
ggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
91174 |
ggtcgaggttcgaaccccggacattgcatatattatgcattgt |
91216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 411 - 457
Target Start/End: Original strand, 73511 - 73557
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
73511 |
tggtggtcggagtttgaaccccggacattgcatacactatgcattgt |
73557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 457
Target Start/End: Original strand, 3568 - 3613
Alignment:
| Q |
413 |
gtggtcggggtttgaaccccggacc-ttgcatatattatgcattgt |
457 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
3568 |
gtggttggggtttgaaccccggacctttgcatattttatgcattgt |
3613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1379 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1379
Description:
Target: scaffold1379; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 1696 - 1660
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1696 |
ggtttgaaccccgaaccttgcatatactatgcattgt |
1660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1149 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold1149
Description:
Target: scaffold1149; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 421 - 457
Target Start/End: Complemental strand, 2392 - 2356
Alignment:
| Q |
421 |
ggtttgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2392 |
ggtttgaaccccaaaccttgcatatattatgcattgt |
2356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Complemental strand, 39454 - 39410
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| ||| ||||| |
|
|
| T |
39454 |
tggtggtcggggtttgaaccccagaccttacatattttaagcatt |
39410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 455
Target Start/End: Original strand, 61561 - 61605
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
455 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
61561 |
tggtggccggggtttgaaccctggaccttacatacattatgcatt |
61605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 425 - 457
Target Start/End: Complemental strand, 122947 - 122915
Alignment:
| Q |
425 |
tgaaccccggaccttgcatatattatgcattgt |
457 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
122947 |
tgaaccccagaccttgcatatattatgcattgt |
122915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 411 - 451
Target Start/End: Original strand, 221004 - 221044
Alignment:
| Q |
411 |
tggtggtcggggtttgaaccccggaccttgcatatattatg |
451 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
221004 |
tggtggtcggggtttgaaccctagactttgcatatattatg |
221044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University