View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21357_high_14 (Length: 220)

Name: NF21357_high_14
Description: NF21357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21357_high_14
NF21357_high_14
[»] chr4 (1 HSPs)
chr4 (23-204)||(30480540-30480721)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 23 - 204
Target Start/End: Complemental strand, 30480721 - 30480540
Alignment:
23 aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgatccaggcatatctcctgtggaatagaaactag 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
30480721 aatggacttgagaatccaaaaaactctgcaaaaatgtcatctgcattcctcggattgaaccgaaacgacccaggcatatctcctgtggaatagaaactag 30480622  T
123 ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30480621 ttccacctccactaccagcatcaggaggaggaacttgaccctttaaaccttcttccccatattgatcatagattgctttctt 30480540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University