View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21357_high_8 (Length: 291)
Name: NF21357_high_8
Description: NF21357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21357_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 280
Target Start/End: Original strand, 23187005 - 23187281
Alignment:
| Q |
18 |
gaacttgcacccaatgtgaagtacataaaatattaacaattttttcatacctagt--------------attcttacttgtaattctcagctactacaag |
103 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||| |||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
23187005 |
gaacttgcacccaatctgaagtacatgaaatattaacaattttttcatccctagtattttgctattagtattcttacttgttattctcagctaccacaag |
23187104 |
T |
 |
| Q |
104 |
atcactacttgtttgtcccaacaaactagtcatcgatcgcgctttcaccattccaatcttcatcctcttcttcgcgataatcaacggcttcttctcatct |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23187105 |
atcactgcttgtttgtcccaacaaactactcatcgatcgcgctttcaccattccaatcttcatcctcttcttcgcgataatcaacggcttcttctcatct |
23187204 |
T |
 |
| Q |
204 |
ttatcttcaccatcaaactttgttagtttttcaagagatggagattcagtttgagatattggattttcaatagaatt |
280 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23187205 |
ttatcttcaccatcaaactttgttagcttttcaagagatggaggttcagtttgagatattggattttcaatagaatt |
23187281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University