View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21358_high_9 (Length: 272)
Name: NF21358_high_9
Description: NF21358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21358_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 35 - 256
Target Start/End: Original strand, 15449140 - 15449360
Alignment:
| Q |
35 |
gttatatatagttaaataaatgtatcttttggaaggaagatattctcttttgaattaagagtttcactaagatagatatgcatgccgatttgaatgataa |
134 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15449140 |
gttatgtatagttaaataaatgtatcttttggaaggaagatattctcttttgaattaagagtttcattaagatagatatgcatgccgatttgaatgataa |
15449239 |
T |
 |
| Q |
135 |
acatatttaatgaataaatctatcttttattcttatcacactcctactttaactcttcacatagatgtgnnnnnnnaattgaattggggcatgagtaaca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15449240 |
acatatttaatgaataaatctatcttttattcttatcatactcctactttaactcttcacatagatgt-tttttttaattgaattggggcatgagtaaca |
15449338 |
T |
 |
| Q |
235 |
ttaattttcaacaaaacataat |
256 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
15449339 |
ttaattttcaacaaaatataat |
15449360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University