View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21358_low_10 (Length: 235)
Name: NF21358_low_10
Description: NF21358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21358_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 9 - 218
Target Start/End: Original strand, 8090536 - 8090746
Alignment:
| Q |
9 |
acaaaaattagtgatactgcaaacgagatgcaaaaaccaaagtcactaaacaacatcagacaaaacttgcaaaggggtcacagtaaataaatgnnnnnnn |
108 |
Q |
| |
|
|||||||||||||||||| || || | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8090536 |
acaaaaattagtgatactacagacaatatgcaaaaaccaaagtcactaaacaacatcagacaaaacttgcaaaggggccacagtaaataaatgaaaaaaa |
8090635 |
T |
|
| Q |
109 |
-gaaccaacggtaattctaaacacagaaagagtacaacacaccagagaactaaagcaagatgagaagaaacacaaatttgatatgtttcttgcttttttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8090636 |
agaaccaacggtaattctaaacacagaaagagtacaacacaccagagaactaaagcaagatgagaagaaacacaaatttgatatgttttttgcttttttg |
8090735 |
T |
|
| Q |
208 |
atgtttgagtt |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
8090736 |
atgtttgagtt |
8090746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University