View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_high_18 (Length: 422)
Name: NF21359_high_18
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 105 - 408
Target Start/End: Original strand, 48657506 - 48657810
Alignment:
| Q |
105 |
attttaacttcatccaattaaggttatctgaattgtggacaaagtaaatgtataattgcagggtgggagtttgtcattttagaggttgcttggtttttgg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48657506 |
attttaacttcatccaattaaggttatctgaattgtggacaaagtaaatgtataattgcagggtgggagtttgtcattttagaggttgcttgctttttgg |
48657605 |
T |
 |
| Q |
205 |
acattatgtattctttttagttaatcttgattggctgatcatttggtttggtctgttgtaatatgcacatcatgtgattattgagtcttacagcaactta |
304 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
48657606 |
acattatgtattttttttagttaatcttgattggctgatcatttggtttggtctgttgtaatatgcacatcatgtgattattgattcttacagcaattta |
48657705 |
T |
 |
| Q |
305 |
tttttgctcttt-nnnnnnntgtataattgggataaagtccttaatataactttaaaatttactcgcaggtgactcatttactattgtacgttggctttg |
403 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48657706 |
tttttgctctttaaaaaaaatgtataattgggataaagtccttaatataactttaaaatttactcgcaggtgactcatttactattgtacgttggctttg |
48657805 |
T |
 |
| Q |
404 |
atagt |
408 |
Q |
| |
|
||||| |
|
|
| T |
48657806 |
atagt |
48657810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University