View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_high_19 (Length: 414)
Name: NF21359_high_19
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 17 - 178
Target Start/End: Complemental strand, 20853492 - 20853336
Alignment:
| Q |
17 |
gaaacaagaatattcaaccactaacccttcattgtttaacaatctgaacaaaaagctgagacaccatttccttgattgatttgagtgtgtgttttgtttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
20853492 |
gaaacaagaatattcaaccactaacccttcattgtttaacaatctgaacaaaaagcagagagaccatttccttgattga-----gtgtgtgttttgtttg |
20853398 |
T |
 |
| Q |
117 |
aatgtagtgataattgatttaattgaatatatgtgtaaaatttaaattcaaggtaacatgta |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20853397 |
aatgtggtgataattgatttaattgaatatatgtgtaaaatttaaattcaaggtaacatgta |
20853336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 177 - 310
Target Start/End: Complemental strand, 20853307 - 20853181
Alignment:
| Q |
177 |
taaatacgcaatgaattcaggcataaaaatcatgtttagaggcnnnnnnnnnnnnnnnnncctcttggctttaggttagaatcaattctaacctagaatt |
276 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20853307 |
taaatacacaatgaattcaggcataaaaatcatgtttagaggc-------aaaaaaaaaacctcttggctttaggttagaatcaattctaacctagaatt |
20853215 |
T |
 |
| Q |
277 |
ctcaaacatgccaaaatacaaattaggaattatt |
310 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
20853214 |
ctcaaacatgtcaaaatacaaattaggaattatt |
20853181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 350 - 397
Target Start/End: Complemental strand, 20853184 - 20853137
Alignment:
| Q |
350 |
tattcagttcggttatcaatcaaaagtgtgaagtaaaatgattcaagt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20853184 |
tattcagttcggttatcaatcaaaagtgtgaagtaaaatgattcaagt |
20853137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University