View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21359_high_41 (Length: 259)

Name: NF21359_high_41
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21359_high_41
NF21359_high_41
[»] chr1 (2 HSPs)
chr1 (21-154)||(4006151-4006286)
chr1 (187-241)||(4004994-4005048)


Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 4006286 - 4006151
Alignment:
21 tgtgtaggaattcgagcaggtcatgtttgaatgcagnnnnnnnnn--act-gttttgtgtgtatgtgattgtattaatttcaatatgtttataactgacg 117  Q
    ||||||||||||||||||||||||||||||||||||           ||| ||||||||||||| |||||||| |||||||||||||||||||||||||     
4006286 tgtgtaggaattcgagcaggtcatgtttgaatgcagtttttttttttacttgttttgtgtgtatatgattgtactaatttcaatatgtttataactgac- 4006188  T
118 ggaaaacaaatatgttgataattttttaatgtgatag 154  Q
    |||||||||||||||||||||||||||||||||||||    
4006187 ggaaaacaaatatgttgataattttttaatgtgatag 4006151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 4005048 - 4004994
Alignment:
187 gtggagggtgtttggtgacaatggtagagtgtccaagtgcatgtttggatctatg 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4005048 gtggagggtgtttggtgacaatggtagagtgtccaagtgcatgtttggatctatg 4004994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University