View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_high_50 (Length: 233)
Name: NF21359_high_50
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_high_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 129 - 200
Target Start/End: Complemental strand, 44786984 - 44786913
Alignment:
| Q |
129 |
gagttcaggagtttcagtcgagatcaatgtatcatgcttggatgctgcatacgtcgatgttcgtatcaatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44786984 |
gagttcaggagtttcagtcgagatcaatgtatcatgcttggatgctgcatatgtcgatgttcgtatcaatct |
44786913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 12 - 133
Target Start/End: Original strand, 44786761 - 44786883
Alignment:
| Q |
12 |
atcatcacataagccattgtgaatttnnnnnnnnn-taatgttgttatatcaattatgattagttacttcgtgttggtaaaatgaagtaaannnnnnnaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44786761 |
atcatcacataagccattgtgaatttaaaaaaataataatgttgttatatcaattatgattagttacttcgtgttggtaaaatgaagtaaaaaaatttaa |
44786860 |
T |
|
| Q |
111 |
cattctcatatttcattcgagtt |
133 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44786861 |
cattctcatatttcattcgagtt |
44786883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 44797682 - 44797629
Alignment:
| Q |
136 |
ggagtttcagtcgagatcaatgtatcatgcttggatgctgcatacgtcgatgtt |
189 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||||| || ||| ||||| |
|
|
| T |
44797682 |
ggagtttccgtagagatcaatatatcatgcttggatgctgcctatgtcaatgtt |
44797629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 44784131 - 44784091
Alignment:
| Q |
136 |
ggagtttcagtcgagatcaatgtatcatgcttggatgctgc |
176 |
Q |
| |
|
|||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
44784131 |
ggagtttctgtcgagatcaacgtctcatgcttggatgctgc |
44784091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University