View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21359_high_56 (Length: 222)

Name: NF21359_high_56
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21359_high_56
NF21359_high_56
[»] chr6 (1 HSPs)
chr6 (16-79)||(26015794-26015857)
[»] chr4 (1 HSPs)
chr4 (16-79)||(56110028-56110091)


Alignment Details
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 26015794 - 26015857
Alignment:
16 attattcttaggtgatttaatatttagttagtagatgcattttgaattttcacttaattgtctt 79  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||||||||    
26015794 attattcttaggtgatttaatatttagttagtagatacattttgagttttcaactaattgtctt 26015857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 56110028 - 56110091
Alignment:
16 attattcttaggtgatttaatatttagttagtagatgcattttgaattttcacttaattgtctt 79  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||||||||    
56110028 attattcttaggtgatttaatatttagttagtagatacattttgagttttcaactaattgtctt 56110091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University