View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_high_57 (Length: 213)
Name: NF21359_high_57
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_high_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 39 - 197
Target Start/End: Original strand, 11280029 - 11280187
Alignment:
| Q |
39 |
ttaaaagtgagttaactcgcaccgaaaaatgtcaagcgtgagttaacttacattgcaacaagggaatgagcagcnnnnnnnnggagaagagtaattttcg |
138 |
Q |
| |
|
|||||||||| |||||| ||||| |||| |||||||||||||||||||||||||||| ||||||||||||| | |||||| || ||||||| |
|
|
| T |
11280029 |
ttaaaagtgaattaacttgcaccaaaaagtgtcaagcgtgagttaacttacattgcagtaagggaatgagcaacaacaaaaaggagaaaagcaattttca |
11280128 |
T |
|
| Q |
139 |
gcgcccccggtgaccataaccttgcgggccaggctgcaagaaatggtcttccaaggatg |
197 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11280129 |
acacccccgatgaccataaccttgcgggccaggctgcaagaaatggtcttccaaggatg |
11280187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 93
Target Start/End: Original strand, 896147 - 896195
Alignment:
| Q |
45 |
gtgagttaactcgcaccgaaaaatgtcaagcgtgagttaacttacattg |
93 |
Q |
| |
|
|||||||||||| | |||||||||||| |||| |||||||||| ||||| |
|
|
| T |
896147 |
gtgagttaactcacgccgaaaaatgtcgagcgagagttaacttccattg |
896195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University