View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_25 (Length: 363)
Name: NF21359_low_25
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 180 - 346
Target Start/End: Complemental strand, 6996720 - 6996554
Alignment:
| Q |
180 |
tggctacatcttaacaaaggacacaaaccaagagcattagctaggaaaatggaggataaactagcaggaggcttctgaatcaccataagagaatctaagt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6996720 |
tggctacatcttaacaaaggacacaaaccaagagcattagctaggaaaatggaggataaactagcaggaggcttctgaatcacaataagagaatctaagt |
6996621 |
T |
 |
| Q |
280 |
taagaatatgtgatctttatatccaaactcacacaacaaacaattacaatctaacccctcaaaattt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6996620 |
taagaatatgtgatctttatatccaaactcacacaacaaacaattacaatctaacccctcaaaattt |
6996554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 85 - 139
Target Start/End: Complemental strand, 6996815 - 6996762
Alignment:
| Q |
85 |
taagtaattagattaaagtactttgcttgtcaaataaacaaagattcgagtatac |
139 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6996815 |
taagtaattagattaa-gtacttagcttgtcaaataaacaaagattcgagtatac |
6996762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University