View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_35 (Length: 316)
Name: NF21359_low_35
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 17448749 - 17449051
Alignment:
| Q |
1 |
gcagaatatgttcttagtaggtttgtccaaacttgtagagcaaggcaacctggatcagatggctggaacaagaaacactaaggtaccttgccacattttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17448749 |
gcagaatatgttcttagtaggtttgtccaaacttgtagagcaaggcaacctggatcagatggctggaacaagaaacactaaggtaccttgccacattttg |
17448848 |
T |
 |
| Q |
101 |
tatgctgatgatataatgattttctgtaaaggaaagagacattgtgtggaagctttaattgattttttcactaagtatgctgaagaatcaggtcagaagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
17448849 |
tatgctgatgatataatgattttctgtaaaggaaagatacattgtgtggaagctttaattgatttgttcactaagtatgctgaagaatcaagtcagaagg |
17448948 |
T |
 |
| Q |
201 |
tgaatcacaacaaatccacaatttttgttggttcaatttcatccacaagattgaatcaactcattgagattattggatttaaccttggcactttttaatg |
300 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17448949 |
tgaatcacaacaaatccacaatttttgctggttcaatttcatccacaagattgaatcaactcattgagattattggatttaaccttgacactttttaatg |
17449048 |
T |
 |
| Q |
301 |
atg |
303 |
Q |
| |
|
||| |
|
|
| T |
17449049 |
atg |
17449051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 137
Target Start/End: Original strand, 12115277 - 12115313
Alignment:
| Q |
101 |
tatgctgatgatataatgattttctgtaaaggaaaga |
137 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12115277 |
tatgctgatgatataatgatcttctgtaaaggaaaga |
12115313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University