View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_38 (Length: 302)
Name: NF21359_low_38
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 171
Target Start/End: Complemental strand, 48106601 - 48106431
Alignment:
| Q |
1 |
ttgaattttaattttaattttaattaactgcgttgttctaattttcaattccatagcatctctcnnnnnnnnnnnnncgttgttcgtctctttgcgtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48106601 |
ttgaattttaattttaattttaattaactgcgttgttctaattttcaattccatagcatctctctttttttctttttcgttgttcgtctctttgcgtggt |
48106502 |
T |
|
| Q |
101 |
aacgttaatcgtaaatttttccgttaagtccattcgtcgtgtcgtaaacttttccgttgagtccgttcgtc |
171 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48106501 |
aacgttactcgtaaatttttccgttaagtccattcgtcgtgtcgtaaacttttccgttgagtccgttcgtc |
48106431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University