View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_41 (Length: 283)
Name: NF21359_low_41
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 266
Target Start/End: Complemental strand, 54234184 - 54233938
Alignment:
| Q |
19 |
gtgtatgagttaggaaagcaatggacgtgaaattaggcatgaggtatgcaatgtaggagcatttcttcttatcaatgttactattaaagattaatcaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54234184 |
gtgtatgagttaggaaagcaatggacgtgaaattaggcatgaggtatgcaatgtaggagcatttcttcttatcaatgttactattaaagatgaatcaaat |
54234085 |
T |
 |
| Q |
119 |
gccataacttgagcctccatttcatagaatttatttctcacatgttgtgccagattgaacttacaagataaattctcggcaaaatacgctttaatttgga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54234084 |
gccataacttgagcctccatttcatagaatttatttctcacatgttgtgccagattgaacttacaagataaatgctcggcaaaatacgctttaatttgga |
54233985 |
T |
 |
| Q |
219 |
gtgtagaatttccatctttattagaaaaattgtatagggctggatatt |
266 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54233984 |
gtgtagaatttccatctttattag-aaaattgtatagggctggatatt |
54233938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University