View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_42 (Length: 275)
Name: NF21359_low_42
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_42 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 44787249 - 44786992
Alignment:
| Q |
18 |
tttttgggacatctagtcgtacgtggcttacgccttgatctcattgagcctggccgtatcgttttctcaatgaagatacctcccaatttacttgttcgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44787249 |
tttttgggacatctagtcgtacgtggcttacgccttgatctcattgagcctggccgtatcgttttctcaatgaagatacctcccaatttacttgttcgta |
44787150 |
T |
 |
| Q |
118 |
tcttactcttttcatctttttatctttccctaataaataacattaatggattttgttctttttcatttatttgcagaattctagtaactgcttacacggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44787149 |
tcttactcttttcatctttttatctttccataataaataacattaatggattttgttctttttcatttatttgcagaattctagtaactgcttacacggt |
44787050 |
T |
 |
| Q |
218 |
ggtgccatcactactttggtggatctggtaggcgcgaccgcagttcccaccgcgggat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
44787049 |
ggtgccatcactactttggtggatctggtaggcgcaactgcagttcccaccgcgggat |
44786992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 54 - 117
Target Start/End: Complemental strand, 44801313 - 44801250
Alignment:
| Q |
54 |
gatctcattgagcctggccgtatcgttttctcaatgaagatacctcccaatttacttgttcgta |
117 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
44801313 |
gatctcattgagcctggccatgtcgttttctcaatgaacatacctccacgtttactcgttcgta |
44801250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 252
Target Start/End: Complemental strand, 44789315 - 44789275
Alignment:
| Q |
212 |
cacggtggtgccatcactactttggtggatctggtaggcgc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
44789315 |
cacggtggtgccatcactactttggtggatgtgataggcgc |
44789275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University