View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_43 (Length: 259)
Name: NF21359_low_43
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 154
Target Start/End: Complemental strand, 4006286 - 4006151
Alignment:
| Q |
21 |
tgtgtaggaattcgagcaggtcatgtttgaatgcagnnnnnnnnn--act-gttttgtgtgtatgtgattgtattaatttcaatatgtttataactgacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
4006286 |
tgtgtaggaattcgagcaggtcatgtttgaatgcagtttttttttttacttgttttgtgtgtatatgattgtactaatttcaatatgtttataactgac- |
4006188 |
T |
|
| Q |
118 |
ggaaaacaaatatgttgataattttttaatgtgatag |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006187 |
ggaaaacaaatatgttgataattttttaatgtgatag |
4006151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 4005048 - 4004994
Alignment:
| Q |
187 |
gtggagggtgtttggtgacaatggtagagtgtccaagtgcatgtttggatctatg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4005048 |
gtggagggtgtttggtgacaatggtagagtgtccaagtgcatgtttggatctatg |
4004994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University