View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21359_low_46 (Length: 253)
Name: NF21359_low_46
Description: NF21359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21359_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 48106774 - 48107019
Alignment:
| Q |
1 |
caagcagataagttatgaagcacataatcattcctcgcttgattttccagaatcgcttgctcagccgttagatctggttgcgttgtctgaatccaattcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48106774 |
caagcagataagttatgaagcacataatcattcctcgcttgattttccagaatcgcttgctcagccgttagatccggttgcgttgtctgaatccaattcg |
48106873 |
T |
 |
| Q |
101 |
gcgggatctggcaccacctacagcagcagtggccggaaacctaaacatcgaaaattgaatctgttgaaattgaacttcaagaatcttgagcttttgtcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48106874 |
gcgggatctggcaccacctacagcagcagtggccggaaacctaaacatcgaaaattgaatctgttgaaattgaacttcaagaatcttgagcttttgtcat |
48106973 |
T |
 |
| Q |
201 |
aacggatagtctactaggccttggatgaaaatctcctcttcatttc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48106974 |
aacggatagtctactaggccttggatgaaaatctcctcttcttttc |
48107019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 51622852 - 51622775
Alignment:
| Q |
1 |
caagcagataagttatgaagcacataatcattcctcgcttgattttccagaatcgcttgctcagccgttagatctggtt |
79 |
Q |
| |
|
||||||||||| || ||| |||||||||| |||||| |||||||||| |||||||| |||| | ||||||||||||| |
|
|
| T |
51622852 |
caagcagataatatacgaaacacataatcactcctcgtttgattttcc-gaatcgctcactcaactgttagatctggtt |
51622775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University